Archives: Solution Manual

Chapter 14 Organizing and Outlining C CHAPTER OBJECTIVES • Understand how to organize main points and supporting material in the body of your speech. • Learn how to develop introductions and conclusions effectively for your speech. • Be able to […]

Chapter 13 Speech Content: Research, Supporting Materials, and Ethics C CHAPTER OBJECTIVES • Learn how to research your speech and cite evidence in your presentation. • Understand how to use supporting materials to develop main ideas and pull audience members […]

Chapter 12 Public Speaking: First Steps C CHAPTER OBJECTIVES • Learn how public speaking is a unique form of communication that everyone uses—in jobs, school, civic engagement, and everyday life. • Identify the steps in the speechmaking process that effective […]

Chapter 11 Problem-Solving and Leading a Small Group C CHAPTER OBJECTIVES • Explore the different characteristics small groups must consider when identifying a problem. • Identify the various ways members can effectively problem-solve as a group. • Distinguish types of […]

Chapter 10 Principles of Group Communication C CHAPTER OBJECTIVES • Demonstrate the importance of small groups to our lives. • Explain the central role of communication in small group dynamics. • Explore several guidelines for improving small group communication in […]

Appendix A Job Interviews A APPENDIX OUTLINE APPENDIX INTRODUCTION • Appendix A opens with a story about Ned, a recently graduated student who returned home to live with his mother while looking for a job. He hoped to find a […]

Chapter 9 Practices for Effective Interpersonal Relationships C CHAPTER OBJECTIVES • Learn the importance of maintaining a variety of relationships through daily behavior and through use of technology. • Explain the dynamics of interpersonal conflict and its impact on the […]

Chapter 8 Principles of Interpersonal Communication C CHAPTER OBJECTIVES • Learn why interpersonal communication, particularly in the dyad, is so important to our personal and social lives. • Understand why we are attracted to others and how these personal relationships […]

Chapter 7 Mass and Mediated Communication C CHAPTER OBJECTIVES • Understand mass media, including its different forms, emerging technologies, and critical theories. • Learn the nature and effects of social media. • Explore media-centric criticism and two theories behind the […]

 Chapter 6 Culture and Communication C CHAPTER OBJECTIVES • Understand and articulate a meaning for culture and intercultural communication. • Describe the most typical variations in culture and how they affect communication. • Develop a mindful approach to intercultural […]

Chapter 5 Listening Skills C CHAPTER OBJECTIVES • Learn how we listen and the different learning styles we use. • Understand the external and internal challenges that keep us from being effective listeners. • Identify strategies to become better listeners […]

Chapter 4 Nonverbal Communication C CHAPTER OBJECTIVES • Identify the functions of nonverbal communication. • Understand the types of nonverbal communication. • Recognize the influence of technology on nonverbal communication. CHAPTER OUTLINE CHAPTER INTRODUCTION • The opening section of the […]

Chapter 3 Verbal Communication C CHAPTER OBJECTIVES • Understand that because language is imperfect and because words have different meanings for different people, we must work to achieve a shared meaning. • Examine the ways that language can accomplish various […]

1 No gestures or movement; distracting behaviors Eye contact 5 Comfortable transition between notes and eye contact with the entire audience 4 Direct eye contact with much of the audience 3 Eye contact focused on one student or section of […]

 Chapter 2 Perceiving Others, Perceiving Ourselves C CHAPTER OBJECTIVES • Understand that our communication with others is based on our perceptions, which are formed either through conscious thinking or through instant mental associations and therefore may not always be […]

USING L LET’S COMMUNICATE IN THE CLASSROOM Let’s Communicate offers instructors several pedagogical resources that can help promote an effective learning environment in the classroom—including critical-thinking discussion questions, suggestions for classroom activities, and the application of skills component. A special […]

SAMPLE SYLLABUS INSTRUCTOR NAME AND CONTACT INFORMATION Instructor: Dr. Jane Doe Office telephone: 555-555-5555 E-mail: Jane.Doe@communication.edu Office location: Communication Hall 123 Office hours: Mondays 2–3 pm, Tuesdays and Thursdays 9-10:30 am, or by appointment My class schedule: MWF 9, 10, […]

SAMPLE COURSE CALENDARS S Sample Semester (15 Weeks) Week 1 Introduction to the course  Purchase the textbook and other materials for class. Week 2 Read Chapters 1–3, Fundamentals of Communication.  Take quizzes for Chapters 1–3. 30 points  […]

SAMPLE ASSIGNMENT GUIDELINES GIVEN TO STUDENTS P Pitching Speech Objective: To determine whether you and the organization are a good match for one another. Personalities are assessed through the interview process. After you and the interviewer move past small talk […]

GRADING RUBRICS Because I use detailed grading rubrics, I can spend less time providing feedback when handing back grades. Students sometimes feel overwhelmed when they first see the rubrics because they see so many words, but the grading rubics answer […]

EVALUATING YOUR STUDENTS E Examinations • When constructing exam questions, think about what you are trying to assess. Instructors are provided a test bank from which to pull questions for assessment purposes, but you may construct your own questions as […]

DEVELOPING YOUR COURSE E Establishing Your Teaching Philosophy If you haven’t yet thought about and written down your teaching philosophy, now is the time to do it. It’s one of those things that should be included in your teaching portfolio. […]

Chapter 1 Introduction to Human Communication C CHAPTER OBJECTIVES • Introduce the study of human communication. • Explore how communication works, why effective communication is essential, and what makes a competent communicator. • Build a foundation of knowledge and skills […]

Answer If random, dispersive replication takes place, the density of the first-generation DNA in the Meselson-Stahl experiment would be the same as was actually observed: a single band midway between heavy and light DNA. In the second generation, however, all […]

Answer The synthesis of protein requires the synthesis of amino acids. The transfer of nitro- gen from an ammonium ion to carbon skeletons—that is, amino acid synthesis—can be carried out in two ways: (1) combination of the NH 3 with […]

Answer This observation suggests that photosynthesis occurs in two phases: (1) a light- dependent phase that generates ATP and NADPH, which are essential for CO 2 fixation, and (2) a light-independent (dark) phase, in which these energy-rich components are used […]

Answer Muscle tissue can convert amino acids to their keto acids plus ammonia, then oxidize the keto acids to produce ATP for muscle contraction. However, urea cannot be formed in reaction of its product with lactate dehydrogenase is an example […]

GG  RT ln [products]/[reactants] and [products]/[reactants] is the mass-action ratio, Q. At equilibrium, G0 and QK eq , so G  RT ln K eq where R8.315 J/mol ⴢK and T25 C 298 K. Using the value RT 2.48 […]

Answer Substance X is cyclic AMP. Epinephrine stimulates glycogen phosphorylase by activating the enzyme adenylyl cyclase, which catalyzes formation of cAMP, the second messenger. (a) Adenylyl cyclase is a membrane-bound protein; centrifugation sediments it into the particulate fraction. (b) Cyclic […]

S-120 Biological Membranes and Transport chapter 11 1. Determining the Cross-Sectional Area of a Lipid Molecule When phospholipids are layered gen- tly onto the surface of water, they orient at the air-water interface with their head groups in the water […]

DNA-Based Information Technologies S-98 1. Engineering Cloned DNA When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises. (a) Draw the structure […]

(a) D -altrose (C-2), D -glucose (C-3), D -gulose (C-4) (b) D -idose (C-2), D -galactose (C-3), D -allose (C-4) (c) D -arabinose (C-2), D -xylose (C-3) S-78 Carbohydrates and Glycobiology chapter 7 1. Sugar Alcohols In the monosaccharide derivatives […]

(i) The concentration of total protein in the cytosol is 0.24 10 5 mol/mL 2.4 10 3 M Thus, for 1 enzyme in 1,000, the enzyme concentration is 2.4 10 6 M (ii) The average molar concentration  Volume of […]

S-29 1. Absolute Configuration of Citrulline The citrulline isolated from watermelons has the structure shown below. Is it a D – or L -amino acid? Explain. 2. Relationship between the Titration Curve and the Acid-Base Properties of Glycine A 100 […]

Answer The mRNA from the trpEDCBA operon encodes several enzymes for tryptophan biosynthesis; the trpB and trpA genes encode tryptophan synthase. The complete trp mRNA is synthesized only when the concentration of tryptophan (actually, that of charged Trp-tRNA) is low. […]

Answer The genetic code is nonoverlapping, unpunctuated, and in triplet (see Fig. 27–7). (a) Gly–Gln–Ser–Leu–Leu–Ile (b) Leu–Asp–Ala–Pro (UAA is a stop codon) (c) His–Asp–Ala–Cys–Cys–Tyr (d) Met–Asp–Glu in eukaryotes; fMet–Asp–Glu in prokaryotes Answer No. Because nearly every amino acid has more […]

Answer For each gene, RNA polymerase produces many RNA transcripts, so an error in any one transcript would result in only a small fraction of protein with an incorrect amino acid residue. This defective protein will probably be degraded quickly. […]

Answer The molecular weight of a single nucleotide pair is 650 (see Problem 1), so the approximate molecular weight of the Mycoplasma DNA molecule is (580,070 bp)(650/bp) 3.8 10 8 Given a length of 3.4 Å per base pair, the […]

Answer Muscle contraction results in a net hydrolysis of ATP. Although the amount of ATP in muscle is very small, the supply can be rapidly replenished by phosphoryl group transfer from the phosphocreatine reservoir, catalyzed by creatine kinase: Phosphocreatine ⫹ADP […]

Answer Recall that “loading” of the acyl carrier protein requires an initial addition of acetyl-CoA, followed by the addition of malonyl-CoA. Malonyl-CoA is normally produced by the addition of CO 2 to acetyl-CoA by acetyl-CoA carboxylase. (a) In the presence […]

Answer Oxidation-reduction reactions require an electron donor and an electron acceptor. Recall that electron donors are reducing agents; electron acceptors are oxidizing agents. (1) NADH is the electron donor (a) and the reducing agent (d); E-FMN is the electron ac- […]

Answer The fatty acids of triacylglycerols are hydrocarbons, with a single carboxyl group. Glycerol, on the other hand, has an OOH group on each carbon and is thus much more highly oxidized than a fatty acid. On oxidation, fatty acids […]

Citrate synthase (a) Acetyl-CoA oxaloacetate H 2 O 88n citrate CoA (b) CoA (c) Condensation Aconitase (a) Citrate 88n isocitrate (b) No cofactors (c) Isomerization Isocitrate dehydrogenase (a) Isocitrate NAD  88n a-ketoglutarate CO 2 NADH (b) NAD  (c) […]

Principles of Metabolic Regulation chapter 15 S-173 1. Measurement of Intracellular Metabolite Concentrations Measuring the concentrations of metabolic intermediates in a living cell presents great experimental difficulties—usually a cell must be destroyed before metabolite concentrations can be measured. Yet enzymes […]

Answer The payoff phase of glycolysis produces ATP, and thus is exergonic. This phase con- sists of five reactions, designated 6 to 10 in the text: 6. Glyceraldehyde 3-phosphate P i NAD  88n 1,3-bisphosphoglycerate NADH H  G  […]

(a) The number of cis double bonds (stearic acid, 18:0; oleic, 18:1; linoleic, 18:2; linolenic, 18:3). Each cis double bond causes a bend in the hydrocarbon chain, and bent chains are less well packed than straight chains in a crystal […]

Answer The complementary strand is (5⬘)GCGCAATATTTTGAGAAATATTGCGC(3⬘) (Note that the sequence of a single strand is always written in the 5⬘→3⬘direction.) This sequence has a palindrome, an inverted repeat with twofold symmetry: (5⬘)GCGCAATATTTCTCAAAATATTGCGC(3⬘) (3⬘)CGCGTTATAAAGAGTTTTATAACGCG(5⬘) Because this sequence is self-complementary, the individual […]

Answer All three situations would produce n H ⬍1.0. An n H (Hill coefficient) of ⬍1.0 gener- ally suggests situation (a)—the classic case of negative cooperativity. However, closer exami- nation of the properties of a protein exhibiting apparent negative cooperativity […]

turns of the ahelix, which are spaced at 5.4 Å intervals; two a-keratin strands twisted into a coiled coil produce the 5.2 Å spacing. The intrinsic stability of the helix (and thus the fiber) results from intra chain hydrogen bonds […]

Answer Using pH log [H  ]: (a) log (1.75 10 5 ) 4.76; (b) log (6.50 10 10 ) 9.19; (c) log (1.0 10 4 ) 4.0; (d) log (1.50 10 5 ) 4.82. Answer Using [H  ] […]