DNA-Based Information
Technologies
S-98
1. Engineering Cloned DNA When joining two or more DNA fragments, a researcher can adjust the
sequence at the junction in a variety of subtle ways, as seen in the following exercises.
(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction
digest (include those sequences remaining from the EcoRI recognition sequence).
(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and
the four deoxynucleoside triphosphates (see Fig. 8–33).
(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in
(b) are ligated (see Fig. 25–16).
(d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that
degrades only single-stranded DNA.
(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (d).
(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction
digest (include those sequences remaining from the PvuII recognition sequence).
(g) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (f).
(h) Suppose you can synthesize a short duplex DNA fragment with any sequence you desire. With
this synthetic fragment and the procedures described in (a) through (g), design a protocol that
would remove an EcoRI restriction site from a DNA molecule and incorporate a new BamHI
restriction site at approximately the same location. (See Fig. 9–2.)
(i) Design four different short synthetic double-stranded DNA fragments that would permit ligation
of structure (a) with a DNA fragment produced by a PstI restriction digest. In one of these
fragments, design the sequence so that the final junction contains the recognition sequences for
both EcoRI and PstI. In the second and third fragments, design the sequence so that the junction
contains only the EcoRI and only the PstI recognition sequence, respectively. Design the
sequence of the fourth fragment so that neither the EcoRI nor the PstI sequence appears in the
junction.
chapter 9
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-98
Chapter 9 DNA-Based Information Technologies S-99
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-99
S-100 Chapter 9 DNA-Based Information Technologies
Chapter 9 DNA-Based Information Technologies S-101
2. Selecting for Recombinant Plasmids When cloning a foreign DNA fragment into a plasmid, it is
often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracy-
cline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify
clones containing recombinant plasmids with foreign DNA. With a bacteriophage lvector it is not nec-
essary to do this, yet one can easily distinguish vectors that incorporate large foreign DNA fragments
from those that do not. How are these recombinant vectors identified?
3. DNA Cloning The plasmid cloning vector pBR322 (see Fig. 9–3) is cleaved with the restriction
endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage)
is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform
bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline.
(a) In addition to the desired recombinant plasmid, what other types of plasmids might be found
among the transformed bacteria that are tetracycline resistant? How can the types be distin-
guished?
(b) The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three
different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giv-
ing the patterns shown below. What does each pattern say about the cloned DNA? Note that in
pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no
cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-101
S-102 Chapter 9 DNA-Based Information Technologies
Answer
750
Electrophoresis
1234
3,000
1,000
250
Nucleotide
length
500
1,500
5,000
Chapter 9 DNA-Based Information Technologies S-103
4. Restriction Enzymes The partial sequence of one strand of a double-stranded DNA molecule is
5—GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG—3
The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.
EcoRI
g
g
*
(5 ) (3 )GAATTC
CTTAAG
*
PstI
g
g
*
(5 ) (3 )CTGCAG
GACGTC
*
5. Designing a Diagnostic Test for a Genetic Disease Huntington disease (HD) is an inherited neu-
rodegenerative disorder, characterized by the gradual, irreversible impairment of psychological, motor,
and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any
age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is becoming
better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein
(M
r
350,000) of unknown function. In individuals who will not develop HD, a region of the gene that
encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine) that is re-
peated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically repeated
40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than 70 times. The
length of this simple trinucleotide repeat indicates whether an individual will develop HD, and at ap-
proximately what age the first symptoms will occur.
Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with
both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand
sequence given above.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:25 PM Page S-103
S-104 Chapter 9 DNA-Based Information Technologies
A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below.
The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the
gene below it, and the CAG repeat is shaded. Using Figure 27–7 to translate the genetic code, outline a
PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must
be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein
is displayed with the coding strand (the sequence identical to the mRNA transcribed from the gene)
on top such that it is read 5to 3, left to right.
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC
M
307
1ATLEKLMKAFESLKS
CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Q
358
18 QFQQQQQQQQQQQQQQ
F
CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG
Q
409
35 QQQQQQQQPP PP PP P P
CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG
P
460
52 PPQLPQPP P
Source: The Huntington’s Disease Collaborative Research Group. (1993) A novel gene containing a trinucleotide
repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983.
6. Using PCR to Detect Circular DNA Molecules In a species of ciliated protist, a segment of
genomic DNA is sometimes deleted. The deletion is a genetically programmed reaction associated with
cellular mating. A researcher proposes that the DNA is deleted in a type of recombination called site-
specific recombination, with the DNA on either end of the segment joined together and the deleted
DNA ending up as a circular DNA reaction product.
proposed
reaction
Suggest how the researcher might use the polymerase chain reaction (PCR) to detect the presence of
the circular form of the deleted DNA in an extract of the protist.
Chapter 9 DNA-Based Information Technologies S-105
7. Glowing Plants When grown in ordinary garden soil and watered normally, a plant engineered to
express green fluorescent protein (see Fig. 9–16) will glow in the dark, whereas a plant engineered to
express firefly luciferase will not. Explain these observations.
8. Designing PCR Primers One strand of a chromosomal DNA sequence is shown below. An investiga-
tor wants to amplify and isolate a DNA fragment defined by the shaded segment, using the polymerase
chain reaction. Design two PCR primers, each 20 nucleotides long, that can be used to amplify this
DNA segment.
5—AATGCCGTCAGCCGATCTGCCTCGAGTCAATCGATGCTGGTAACTTGGGGTATAAAGCT
TACCCATGGTATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTTCTGGTATTGGTT
TAGGGTCTTTGATGCTATTAATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATGTTTTAAGC
CGGGTTTTGTCTGGGATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG—3
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-105
S-106 Chapter 9 DNA-Based Information Technologies
9. Mapping a Chromosome Segment A group of overlapping clones, designated A through F, is isolated
from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme and
the pieces resolved by agarose gel electrophoresis, with the results shown below. There are nine differ-
ent restriction fragments in this chromosomal region, with a subset appearing in each clone. Using this
information, deduce the order of the restriction fragments in the chromosome.
Electrophoresis
1
2
3
4
5
6
7
8
9
Overlapping clones
ABCDEF
Nine
restriction
fragments
Chapter 9 DNA-Based Information Technologies S-107
10. Immunofluorescence In the more common protocol for immunofluorescence detection of cellular
proteins, an investigator uses two antibodies. The first binds specifically to the protein of interest. The
second is labeled with fluorochromes for easy visualization, and it binds to the first antibody. In princi-
ple, one could simply label the first antibody and skip one step. Why use two successive antibodies?
11. Yeast Two-Hybrid Analysis You are a researcher who has just discovered a new protein in a fungus.
Design a yeast two-hybrid experiment to identify the other proteins in the fungal cell with which your
protein interacts and explain how this could help you determine the function of your protein.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-107
S-108 Chapter 9 DNA-Based Information Technologies
12. Use of Photolithography to Make a DNA Microarray Figure 9–22 shows the first steps in the
process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining
steps needed to obtain the desired sequences (a different four-nucleotide sequence on each of the
four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide se-
quence attached at each spot.
13. Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps
where no sequence information has been obtained. To close the gaps, DNA primers complementary to
the 5-ending strand (i.e., identical to the sequence of the 3-ending strand) at the end of each contig
are especially useful. Explain how these primers might be used.
14. Use of Outgroups in Comparative Genomics A hypothetical protein is found in orangutans,
chimpanzees, and humans that has the following sequences (bold indicates the amino acid residue
differences):
Human: ATSAAGYDEWEGGKVLIHL– – KLQNRGALLELDIGAV
Orangutan: ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV
Chimpanzee: ATSAAGWDEWEGGKILIHLDGKLQNRGALLELDIGAV
(Dashes indicate a deletion—the residues are missing in that sequence.)
What is the most likely sequence of the protein present in the last common ancestor of chim-
panzees and humans?
Chapter 9 DNA-Based Information Technologies S-109
15. Finding Disease Genes You are a gene hunter, trying to find the genetic basis for a case inherited
disease. Examination of six pedigrees of families affected by the disease provides inconsistent results.
For two of the families, the disease is co-inherited with markers on chromosome 7. For the other four
families, the disease is co-inherited with markers on chromosome 12. Explain how this might occur.
Data Analysis Problem
16. HincII: The First Restriction Endonuclease Discovery of the first restriction endonuclease to be of
practical use was reported in two papers published in 1970. In the first paper, Smith and Wilcox de-
scribed the isolation of an enzyme that cleaved double-stranded DNA. They initially demonstrated the
enzyme’s nuclease activity by measuring the decrease in viscosity of DNA samples treated with the
enzyme.
(a) Why does treatment with a nuclease decrease the viscosity of a solution of DNA?
The authors determined whether the enzyme was an endo- or an exonuclease by treating
32
P-labeled
DNA with the enzyme, then adding trichloroacetic acid (TCA). Under the conditions used in their experi-
ment, single nucleotides would be TCA-soluble and oligonucleotides would precipitate.
(b) No TCA-soluble
32
P-labeled material formed on treatment of
32
P-labeled DNA with the nuclease.
Based on this finding, is the enzyme an endo- or exonuclease? Explain your reasoning.
When a polynucleotide is cleaved, the phosphate usually is not removed but remains attached to
the 5or 3end of the resulting DNA fragment. Smith and Wilcox determined the location of the phos-
phate on the fragment formed by the nuclease in the following steps:
1. Treat unlabeled DNA with the nuclease.
2. Treat a sample (A) of the product with
32
P-labeled ATP and polynucleotide kinase (which
can attach the -phosphate of ATP to a 5OH but not to a 5phosphate or to a 3OH or 3
phosphate). Measure the amount of
32
P incorporated into the DNA.
3. Treat another sample (B) of the product of step 1 with alkaline phosphatase (which removes
phosphate groups from free 5and 3ends), followed by polynucleotide kinase and
32
P-labeled ATP. Measure the amount of
32
P incorporated into the DNA.
(c) Smith and Wilcox found that sample A had 136 counts/min of
32
P; sample B had 3,740
counts/min. Did the nuclease cleavage leave the phosphate on the 5or the 3end of the DNA
fragments? Explain your reasoning.
(d) Treatment of bacteriophage T7 DNA with the nuclease gave approximately 40 specific fragments
of various lengths. How is this result consistent with the enzyme’s recognizing a specific
sequence in the DNA as opposed to making random double-strand breaks?
At this point, there were two possibilities for the site-specific cleavage: the cleavage occurred either
(1) at the site of recognition or (2) near the site of recognition but not within the sequence recognized.
To address this issue, Kelly and Smith determined the sequence of the 5ends of the DNA fragments
generated by the nuclease, in the following steps:
1. Treat phage T7 DNA with the enzyme.
2. Treat the resulting fragments with alkaline phosphatase to remove the 5phosphates.
3. Treat the dephosphorylated fragments with polynucleotide kinase and
32
P-labeled ATP to
label the 5ends.
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-109
S-110 Chapter 9 DNA-Based Information Technologies
4. Treat the labeled molecules with DNases to break them into a mixture of mono-, di-, and
trinucleotides.
5. Determine the sequence of the labeled mono-, di-, and trinucleotides by comparing them with
oligonucleotides of known sequence on thin-layer chromatography.
The labeled products were identified as follows: mononucleotides: A and G; dinucleotides:
(5)ApA-(3) and (5)GpA(3); trinucleotides: (5)ApApC(3) and (5)GpApC(3).
(e) Which model of cleavage is consistent with these results? Explain your reasoning.
Kelly and Smith went on to determine the sequence of the 3ends of the fragments. They found a
mixture of (5)TpC(3) and (5)TpT(3). They did not determine the sequence of any trinucleotides
at the 3end.
(f) Based on these data, what is the recognition sequence for the nuclease and where in the
sequence is the DNA backbone cleaved? Use Table 9–2 as a model for your answer.
Answer
c09DNA-BasedInformationTechnologies.qxd 12/6/12 4:26 PM Page S-111