Archives

(a) The magnified cell would have a diameter of 50 10 4 mm 500 10 3 mm 500 mm, or 20 inches—about the diameter of a large pizza. molecule, in cubic meters, is (4/3)(3.14)(1.8 10 9 m) 3 2.4 10 […]

Chapter 1 The Foundations of Biochemistry Multiple Choice Questions 1. Cellular foundations In a bacterial cell, the DNA is in the: A) cell envelope. B) cell membrane. C) nucleoid. D) nucleus. E) ribosomes. 2. Cellular foundations Page: 3 Difficulty: 1 […]

(a) The number of cis double bonds (stearic acid, 18:0; oleic, 18:1; linoleic, 18:2; linolenic, 18:3). Each cis double bond causes a bend in the hydrocarbon chain, and bent chains are less well packed than straight chains in a crystal […]

Chapter 10 Lipids Multiple Choice Questions 1. Storage Lipids Which of the following molecules or substances contain, or are derived from, fatty acids? A) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived […]

Chapter 11 Biological Membranes and Transport Multiple Choice Questions 1. The composition and architecture of membranes Which one of the following statements about membranes is true? A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common […]

S-120 Biological Membranes and Transport chapter 11 1. Determining the Cross-Sectional Area of a Lipid Molecule When phospholipids are layered gen- tly onto the surface of water, they orient at the air-water interface with their head groups in the water […]

Chapter 12 Biosignaling Multiple Choice Questions 1. General Features of Signal Transduction Which of the following is not involved in the specificity of signal transduction? A) Interactions between receptor and signal molecules B) Location of receptor molecules C) Structure of […]

Answer Substance X is cyclic AMP. Epinephrine stimulates glycogen phosphorylase by activating the enzyme adenylyl cyclase, which catalyzes formation of cAMP, the second messenger. (a) Adenylyl cyclase is a membrane-bound protein; centrifugation sediments it into the particulate fraction. (b) Cyclic […]

Chapter 13 Principles of Bioenergetics Multiple Choice Questions 1. Bioenergetics and thermodynamics If the G’° of the reaction A → B is –40 kJ/mol, under standard conditions the reaction: A) is at equilibrium. B) will never reach equilibrium. C) will […]

GG  RT ln [products]/[reactants] and [products]/[reactants] is the mass-action ratio, Q. At equilibrium, G0 and QK eq , so G  RT ln K eq where R8.315 J/mol ⴢK and T25 C 298 K. Using the value RT 2.48 […]

Chapter 14 Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway Multiple Choice Questions 1. Glycolysis Glycolysis is the name given to a metabolic pathway occurring in many different cell types. It consists of 11 enzymatic steps that convert glucose to lactic […]

Answer The payoff phase of glycolysis produces ATP, and thus is exergonic. This phase con- sists of five reactions, designated 6 to 10 in the text: 6. Glyceraldehyde 3-phosphate P i NAD  88n 1,3-bisphosphoglycerate NADH H  G  […]

Principles of Metabolic Regulation chapter 15 S-173 1. Measurement of Intracellular Metabolite Concentrations Measuring the concentrations of metabolic intermediates in a living cell presents great experimental difficulties—usually a cell must be destroyed before metabolite concentrations can be measured. Yet enzymes […]

Chapter 15 Principles of Metabolic Regulation Multiple Choice Questions 1. Which of the following does not contribute to the regulation of enzymatic activity? A) Protein phosphorylation B) Allosteric regulation C) Protein stability D) mRNA stability E) DNA stability Regulation of […]

Citrate synthase (a) Acetyl-CoA oxaloacetate H 2 O 88n citrate CoA (b) CoA (c) Condensation Aconitase (a) Citrate 88n isocitrate (b) No cofactors (c) Isomerization Isocitrate dehydrogenase (a) Isocitrate NAD  88n a-ketoglutarate CO 2 NADH (b) NAD  (c) […]

Chapter 16 The Citric Acid Cycle Multiple Choice Questions 1. Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex? A) Biotin participates in the decarboxylation. B) Both NAD+ and a flavin nucleotide act […]

Answer The fatty acids of triacylglycerols are hydrocarbons, with a single carboxyl group. Glycerol, on the other hand, has an OOH group on each carbon and is thus much more highly oxidized than a fatty acid. On oxidation, fatty acids […]

Chapter 17 Fatty Acid Catabolism Multiple Choice Questions 1. Lipoprotein lipase acts in: A) hydrolysis of triacylglycerols of plasma lipoproteins to supply fatty acids to various tissues. B) intestinal uptake of dietary fat. C) intracellular lipid breakdown of lipoproteins. D) […]

Chapter 18 Amino Acid Oxidation and the Production of Urea Multiple Choice Questions 1. Under which circumstances are amino acids not metabolized via oxidative degradation? A) Starvation B) Plants growing in nutrient-rich soils C) Normal protein turnover D) A diet […]

Answer Muscle tissue can convert amino acids to their keto acids plus ammonia, then oxidize the keto acids to produce ATP for muscle contraction. However, urea cannot be formed in reaction of its product with lactate dehydrogenase is an example […]

Chapter 19 Oxidative Phosphorylation and Photophosphorylation Multiple Choice Questions 1. Almost all of the oxygen (O2) one consumes in breathing is converted to: A) acetyl-CoA. B) carbon dioxide (CO2). C) carbon monoxide and then to carbon dioxide. D) None of […]

Answer Oxidation-reduction reactions require an electron donor and an electron acceptor. Recall that electron donors are reducing agents; electron acceptors are oxidizing agents. (1) NADH is the electron donor (a) and the reducing agent (d); E-FMN is the electron ac- […]

Chapter 19 Oxidative Phosphorylation and Photophosphorylation 231 Short Answer Questions 44. As you read and answer this question, you are (presumably) consuming oxygen. What single reaction accounts for most of your oxygen consumption? 45. Show the path of electrons from […]

12 Chapter 2 Water Multiple Choice Questions 1. Weak interactions in aqueous systems Which of these statements about hydrogen bonds is not true? A) Hydrogen bonds account for the anomalously high boiling point of water. B) In liquid water, the […]

Answer Using pH log [H  ]: (a) log (1.75 10 5 ) 4.76; (b) log (6.50 10 10 ) 9.19; (c) log (1.0 10 4 ) 4.0; (d) log (1.50 10 5 ) 4.82. Answer Using [H  ] […]

Chapter 20 Carbohydrate Biosynthesis in Plants and Bacteria Multiple Choice Questions 1. Which of the following is not true about plastids? A) Most of the proteins in a plastid are encoded in nuclear genes. B) Plastids are encoded by a […]

Answer This observation suggests that photosynthesis occurs in two phases: (1) a light- dependent phase that generates ATP and NADPH, which are essential for CO 2 fixation, and (2) a light-independent (dark) phase, in which these energy-rich components are used […]

Answer Recall that “loading” of the acyl carrier protein requires an initial addition of acetyl-CoA, followed by the addition of malonyl-CoA. Malonyl-CoA is normally produced by the addition of CO 2 to acetyl-CoA by acetyl-CoA carboxylase. (a) In the presence […]

Chapter 21 Lipid Biosynthesis Multiple Choice Questions 1. Which of the following is not required in the synthesis of fatty acids? A) Acetyl-CoA B) Biotin C) HCO3 – (CO2) D) Malonyl-CoA E) NADH 2. Which of the following is not […]

Chapter 22 Biosynthesis of Amino Acids, Nucleotides, and Related Molecules Multiple Choice Questions 1. Which of the following statements about the fixation of atmospheric nitrogen (N2) into NH3 by living cells is false? A) It involves the transfer of eight […]

Answer The synthesis of protein requires the synthesis of amino acids. The transfer of nitro- gen from an ammonium ion to carbon skeletons—that is, amino acid synthesis—can be carried out in two ways: (1) combination of the NH 3 with […]

Answer Muscle contraction results in a net hydrolysis of ATP. Although the amount of ATP in muscle is very small, the supply can be rapidly replenished by phosphoryl group transfer from the phosphocreatine reservoir, catalyzed by creatine kinase: Phosphocreatine ⫹ADP […]

Chapter 23 Integration and Hormonal Regulation of Mammalian Metabolism Multiple Choice Questions 1. The radioimmunossay (RIA) is based on competition of unlabeled and radiolabeled: A) antibodies for binding to a hormone. B) antibodies for binding to a receptor. C) hormone […]

Chapter 24 Genes and Chromosomes Multiple Choice Questions 1. The most precise modern definition of a gene is a segment of genetic material that: A) codes for one polypeptide. B) codes for one polypeptide or RNA product. C) determines one […]

Answer The molecular weight of a single nucleotide pair is 650 (see Problem 1), so the approximate molecular weight of the Mycoplasma DNA molecule is (580,070 bp)(650/bp) 3.8 10 8 Given a length of 3.4 Å per base pair, the […]

Chapter 25 DNA Metabolism Multiple Choice Questions 1. The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis. B) DNA synthesis in E. coli proceeds by a conservative mechanism. C) DNA synthesis in E. coli […]

Answer If random, dispersive replication takes place, the density of the first-generation DNA in the Meselson-Stahl experiment would be the same as was actually observed: a single band midway between heavy and light DNA. In the second generation, however, all […]

Answer For each gene, RNA polymerase produces many RNA transcripts, so an error in any one transcript would result in only a small fraction of protein with an incorrect amino acid residue. This defective protein will probably be degraded quickly. […]

Chapter 26 RNA Metabolism Multiple Choice Questions 1. RNA polymerase: A) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed. B) can synthesize RNA chains without a primer. C) has a […]

Chapter 27 Protein Metabolism Multiple Choice Questions 1. A certain bacterial mRNA is known to represent only one gene and to contain about 800 nucleotides. If you assume that the average amino acid residue contributes 110 to the peptide molecular […]

Answer The genetic code is nonoverlapping, unpunctuated, and in triplet (see Fig. 27–7). (a) Gly–Gln–Ser–Leu–Leu–Ile (b) Leu–Asp–Ala–Pro (UAA is a stop codon) (c) His–Asp–Ala–Cys–Cys–Tyr (d) Met–Asp–Glu in eukaryotes; fMet–Asp–Glu in prokaryotes Answer No. Because nearly every amino acid has more […]

Answer The mRNA from the trpEDCBA operon encodes several enzymes for tryptophan biosynthesis; the trpB and trpA genes encode tryptophan synthase. The complete trp mRNA is synthesized only when the concentration of tryptophan (actually, that of charged Trp-tRNA) is low. […]

Chapter 28 Regulation of Gene Expression Multiple Choice Questions 1. “Housekeeping genes” in bacteria are commonly expressed constitutively, but not all of these genes are expressed at the same level (the same number of molecules per cell). The primary mechanism […]

Chapter 3 Amino Acids, Peptides, and Proteins Multiple Choice Questions 1. Amino acids The chirality of an amino acid results from the fact that its  carbon: A) has no net charge. B) is a carboxylic acid. C) is bonded […]

S-29 1. Absolute Configuration of Citrulline The citrulline isolated from watermelons has the structure shown below. Is it a D – or L -amino acid? Explain. 2. Relationship between the Titration Curve and the Acid-Base Properties of Glycine A 100 […]

turns of the ahelix, which are spaced at 5.4 Å intervals; two a-keratin strands twisted into a coiled coil produce the 5.2 Å spacing. The intrinsic stability of the helix (and thus the fiber) results from intra chain hydrogen bonds […]

Chapter 4 The Three-Dimensional Structure of Proteins Multiple Choice Questions 1. Overview of protein structure All of the following are considered “weak” interactions in proteins except: A) hydrogen bonds. B) hydrophobic interactions. C) ionic bonds. D) peptide bonds. E) van […]

Answer All three situations would produce n H ⬍1.0. An n H (Hill coefficient) of ⬍1.0 gener- ally suggests situation (a)—the classic case of negative cooperativity. However, closer exami- nation of the properties of a protein exhibiting apparent negative cooperativity […]

Chapter 5 Protein Function Multiple Choice Questions 1. Reversible binding of a protein to a ligand: oxygen-binding proteins The interactions of ligands with proteins: A) are relatively nonspecific. B) are relatively rare in biological systems. C) are usually irreversible. D) […]

Chapter 6 Enzymes Multiple Choice Questions 1. An introduction to enzymes One of the enzymes involved in glycolysis, aldolase, requires Zn2+ for catalysis. Under conditions of zinc deficiency, when the enzyme may lack zinc, it would be referred to as […]

(i) The concentration of total protein in the cytosol is 0.24 10 5 mol/mL 2.4 10 3 M Thus, for 1 enzyme in 1,000, the enzyme concentration is 2.4 10 6 M (ii) The average molar concentration  Volume of […]

Chapter 7 Carbohydrates and Glycobiology Multiple Choice Questions 1. Monosaccharides and disaccharides To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose. 2. Monosaccharides and disaccharides Page: 244 Difficulty: 2 […]

(a) D -altrose (C-2), D -glucose (C-3), D -gulose (C-4) (b) D -idose (C-2), D -galactose (C-3), D -allose (C-4) (c) D -arabinose (C-2), D -xylose (C-3) S-78 Carbohydrates and Glycobiology chapter 7 1. Sugar Alcohols In the monosaccharide derivatives […]

Answer The complementary strand is (5⬘)GCGCAATATTTTGAGAAATATTGCGC(3⬘) (Note that the sequence of a single strand is always written in the 5⬘→3⬘direction.) This sequence has a palindrome, an inverted repeat with twofold symmetry: (5⬘)GCGCAATATTTCTCAAAATATTGCGC(3⬘) (3⬘)CGCGTTATAAAGAGTTTTATAACGCG(5⬘) Because this sequence is self-complementary, the individual […]

Chapter 8 Nucleotides and Nucleic Acids Multiple Choice Questions 1. Some basics The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) […]

Chapter 9 DNA-Based Information Technologies Multiple Choice Questions 1. Studying genes and their products Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon […]

DNA-Based Information Technologies S-98 1. Engineering Cloned DNA When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises. (a) Draw the structure […]