Chapter 25 DNA Metabolism
Multiple Choice Questions
1. The Meselson-Stahl experiment established that:
A) DNA polymerase has a crucial role in DNA synthesis.
B) DNA synthesis in E. coli proceeds by a conservative mechanism.
C) DNA synthesis in E. coli proceeds by a semiconservative mechanism.
D) DNA synthesis requires dATP, dCTP, dGTP, and dTTP.
E) newly synthesized DNA in E. coli has a different base composition than the preexisting DNA.
2. When a DNA molecule is described as replicating bidirectionally, that means that it has two:
A) chains.
B) independently replicating segment.
C) origins.
D) replication forks.
E) termination points.
3. An Okazaki fragment is a:
A) fragment of DNA resulting from endonuclease action.
B) fragment of RNA that is a subunit of the 30S ribosome.
C) piece of DNA that is synthesized in the 3‘ → 5‘ direction.
D) segment of DNA that is an intermediate in the synthesis of the lagging strand.
E) segment of mRNA synthesized by RNA polymerase.
4. Which one of the following statements about enzymes that interact with DNA is true?
A) E. coli DNA polymerase I is unusual in that it possesses only a 5‘ → 3‘ exonucleolytic activity.
B) Endonucleases degrade circular but not linear DNA molecules.
C) Exonucleases degrade DNA at a free end.
D) Many DNA polymerases have a proofreading 5‘ → 3‘ exonuclease.
E) Primases synthesize a short stretch of DNA to prime further synthesis.
Chapter 25 DNA Metabolism
290
5. E. coli DNA polymerase III:
A) can initiate replication without a primer.
B) is efficient at nick translation.
C) is the principal DNA polymerase in chromosomal DNA replication.
D) represents over 90% of the DNA polymerase activity in E. coli cells.
E) requires a free 5‘-hydroxyl group as a primer.
6. The proofreading function of DNA polymerase involves all of the following except:
A) a 3‘ → 5‘ exonuclease.
B) base pairing.
C) detection of mismatched base pairs.
D) phosphodiester bond hydrolysis.
E) reversal of the polymerization reaction.
7. The 5‘ → 3‘ exonuclease activity of E. coli DNA polymerase I is involved in:
A) formation of a nick at the DNA replication origin.
B) formation of Okazaki fragments.
C) proofreading of the replication process.
D) removal of RNA primers by nick translation.
E) sealing of nicks by ligase action.
8. Prokaryotic DNA polymerase III:
A) contains a 5‘ → 3‘ proofreading activity to improve the fidelity of replication.
B) does not require a primer molecule to initiate replication.
C) has a
subunit that acts as a circular clamp to improve the processivity of DNA synthesis.
D) synthesizes DNA in the 3‘ → 5‘ direction.
E) synthesizes only the leading strand; DNA polymerase I synthesizes the lagging strand.
9. Which of the following is not required for initiation of DNA replication in E. coli?
A) DnaB (helicase)
B) DnaG (primase)
C) Dam methylase
D) DNA ligase
Chapter 25 DNA Metabolism
291
E) DnaA (a AAA+ ATPase)
10. At replication forks in E. coli:
A) DNA helicases make endonucleolytic cuts in DNA.
B) DNA primers are degraded by exonucleases.
C) DNA topoisomerases make endonucleolytic cuts in DNA.
D) RNA primers are removed by primase.
E) RNA primers are synthesized by primase.
11. Which of the following is not required for elongation during DNA replication in E. coli?
A) DnaB (helicase)
B) DnaG (primase)
C) DnaC
D)
-sliding clamp
E) Clamp loader
12. In contrast to bacteria, eukaryotic chromosomes need multiple DNA replication origins because:
A) eukaryotic chromosomes cannot usually replicate bidirectionally.
B) eukaryotic genomes are not usually circular, like the bacterial chromosome is.
C) the processivity of the eukaryotic DNA polymerase is much less than the bacterial enzyme.
D) their replication rate is much slower, and it would take too long with only a single origin per
chromosome.
E) they have a variety of DNA polymerases for different purposes, and need a corresponding variety
of replication origins.
13. The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is
similar to that of the
-subunit of bacterial DNA polymerase III in that it:
A) facilitates replication of telomeres.
B) forms a circular sliding clamp to increase the processivity of replication.
C) has a 3‘ → 5‘ proofreading activity.
D) increases the speed but not the processivity of the replication complex.
E) participates in DNA repair.
Chapter 25 DNA Metabolism
292
14. The Ames test is used to:
A) detect bacterial viruses.
B) determine the rate of DNA replication.
C) examine the potency of antibiotics.
D) measure the mutagenic effects of various chemical compounds.
E) quantify the damaging effects of UV light on DNA molecules.
15. In a mammalian cell, DNA repair systems:
A) are extraordinarily efficient energetically.
B) are generally absent, except in egg and sperm cells.
C) can repair deletions, but not mismatches.
D) can repair most types of lesions except those caused by UV light.
E) normally repair more than 99% of the DNA lesions that occur.
16. Which of these enzymes is not directly involved in methyl-directed mismatch repair in E. coli?
A) DNA glycosylase
B) DNA helicase II
C) DNA ligase
D) DNA polymerase III
E) Exonuclease I
17. The role of the Dam methylase is to:
A) add a methyl group to uracil, converting it to thymine.
B) modify the template strand for recognition by repair systems.
C) remove a methyl group from thymine.
D) remove a mismatched nucleotide from the template strand.
E) replace a mismatched nucleotide with the correct one.
18. When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-
directed repair system:
A) cannot distinguish the template strand from the newly replicated strand.
B) changes both the template strand and the newly replicated strand.
C) corrects the DNA strand that is methylated.
Chapter 25 DNA Metabolism
293
D) corrects the mismatch by changing the newly replicated strand.
E) corrects the mismatch by changing the template strand.
19. In base-excision repair, the first enzyme to act is:
A) AP endonuclease.
B) Dam methylase.
C) DNA glycosylase.
D) DNA ligase.
E) DNA polymerase.
20. The ABC excinuclease is essential in:
A) base-excision repair.
B) methyl-directed repair.
C) mismatch repair.
D) nucleotide-excision repair.
E) SOS repair.
21. The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:
A) coenzyme A.
B) coenzyme Q.
C) FADH–.
D) pyridoxal phosphate (PLP).
E) thiamine pyrophosphate (TPP).
22. Which mechanism is used to repair a thymidine dimer in DNA?
A) Mismatch repair
B) Base-excision repair
C) Nucleotide-excision repair
D) Direct repair
E) More than one is used for this type of lesion
23. Which mechanism is used to repair a chemically modified base in DNA?
Chapter 25 DNA Metabolism
294
A) Mismatch repair
B) Base-excision repair
C) Nucleotide-excision repair
D) Direct repair
E) More than one is used for this type of lesion
24. An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation
rate, because:
A) alternative modified nucleotides can be incorporated more readily.
B) interference from the RecA and SSB proteins hinders the normal replication accuracy.
C) replication proceeds much faster than normal, resulting in many more mistakes.
D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III.
E) the DNA polymerases involved lack exonuclease proofreading activities.
25. In homologous recombination in E. coli, the protein that moves along a double-stranded DNA,
unwinding the strands ahead of it and degrading them, is:
A) chi.
B) DNA ligase.
C) RecA protein.
D) RecBCD enzyme.
E) RuvC protein (resolvase).
26. In homologous recombination in E. coli, the protein that assembles into long, helical filaments that
coat a region of DNA is:
A) DNA methylase.
B) DNA polymerase.
C) histone.
D) RecA protein.
E) RecBCD enzyme.
27. In homologous genetic recombination, RecA protein is involved in:
A) formation of Holliday intermediates and branch migration.
B) introduction of negative supercoils into the recombination products.
C) nicking the two duplex DNA molecules to initiate the reaction.
Chapter 25 DNA Metabolism
295
D) pairing a DNA strand from one duplex DNA molecule with sequences in another duplex,
regardless of complementarity.
E) resolution of the Holliday intermediate.
28. Which of the following statements is false? In vitro, the strand-exchange reaction:
A) can include formation of a Holliday intermediate.
B) is accompanied by ATP hydrolysis.
C) may involve transient formation of a three– or four-stranded DNA complex.
D) needs RecA protein.
E) requires DNA polymerase.
29. Which of the following is not a feature of homologous recombination during meiosis?
A) A double strand break
B) Cleavage of two crossover events
C) Alignment of homologous chromosomes
D) Formation of a single Holliday intermediate
E) Exposed 3‘ ends invade the intact duplex DNA of the homolog
30. Which of the following is not a feature of site-specific recombination?
A) A specific recombinase enzyme is required.
B) The energy of the phosphodiester bond is preserved in covalent enzyme-DNA linkage.
C) Recombination sites have non-palindromic sequences.
D) Formation of Holliday intermediates is required.
E) Insertions or deletions can result from site-specific recombination.
31. Which of the following is false about transposition of DNA?
A) The diversity of immunoglobins is in part due to DNA recombination by transposition.
B) Transposition occurs in both prokaryotes and eukaryotes.
C) Enzymes are not required for transposition.
D) The first step of transposition can be single– or double-stranded DNA cleavage.
E) Transposition can lead to simple movement of a DNA region or duplication of that region in a
new location.
Chapter 25 DNA Metabolism
296
Short Answer Questions
32. Describe briefly how equilibrium density gradient centrifugation was used to demonstrate that DNA
replication in E. coli is semiconservative.
33. The DNA below is replicated from left to right. Label the templates for leading strand and lagging
strand synthesis.
(5‘)ACTTCGGATCGTTAAGGCCGCTTTCTGT(3‘)
(3‘)TGAAGCCTAGCAATTCCGGCGAAAGACA(5‘)
34. All known DNA polymerases catalyze synthesis only in the 5‘ → 3‘ direction. Nevertheless, during
semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter
chains, which would appear to require synthesis in the 3‘ → 5‘ direction. Explain the process that
occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase.
35. What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?
Chapter 25 DNA Metabolism
297
36. Diagram the reaction catalyzed by DNA polymerase that occurs between deoxyribose at the end of a
DNA chain and the 5‘ phosphates of a deoxyribonucleoside triphosphate. Include the chemical
structure of the phosphate group, indicate the locations of the sugar and base, and show the
rearrangements of electrons that occur.
37. Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one
phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently
both in a test tube and in the cell. Explain.
38. A suitable substrate for DNA polymerase is shown below. Label the primer and template, and
indicate which end of each strand must be 3‘ or 5‘.
To observe DNA synthesis on this substrate in vitro, what additional reaction components must be
added?
39. All known DNA polymerases can only elongate a preexisting DNA chain (i.e., require a primer) but
cannot initiate a new DNA chain. Nevertheless, during semiconservative DNA replication in the cell,
entirely new daughter DNA chains are synthesized. Explain the process that occurs in the cell that
allows for the synthesis of daughter chains by DNA polymerase.
Chapter 25 DNA Metabolism
298
40. DNA replication in E. coli begins at a site in the DNA called the (a) ___________. At the replication
fork the (b) ___________ strand is synthesized continuously while the (c) _________ strand is
synthesized discontinuously. On the strand synthesized discontinuously, the short pieces are called
(d) ____________ fragments. An RNA primer for each of the fragments is synthesized by an enzyme
called (e) __________, and this RNA primer is removed after the fragment is synthesized by the
enzyme (f) ___________, using its (g) _____________ activity. The nicks left behind in this process
are sealed by the enzyme (h) _____________.
41. Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli:
(a) DNA helicase; (b) primase; (c) the 3‘ → 5‘ exonuclease activity of DNA polymerase; (d) DNA
1igase; (e) topoisomerases; (f) the 5‘ → 3‘ exonuclease activity of DNA polymerase I.
42. DNA synthesis on the lagging strand in E. coli is a complex process known to involve several
proteins. Initiation of a new chain is catalyzed by the enzyme (a) _____________, and elongation is
catalyzed by the enzyme (b)______________. Synthesis is discontinuous, yielding short segments
called (c) _______________, which are eventually joined by the enzyme (d)______________, which
requires the cofactor (e)___________.
43. List two proteins or enzymes, other than DNA polymerase III, that are found at the replication fork in
E. coli. Describe each of their functions with no more than one sentence.
Chapter 25 DNA Metabolism
299
44. In the bacterial cell, what are catenated chromosomes, when do they arise, and how does the cell
resolve the problem posed by their structure?
45. Why is the drug acyclovir effective against the herpes simplex virus?
46. The high fidelity of DNA replication is due primarily to immediate error correction by the 3‘ —> 5‘
exonuclease (proofreading) activity of the DNA polymerase. Some incorrectly paired bases escape
this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA.
List the four classes of repair mechanisms that the cell can use to help correct such errors.
47. List three types of DNA damage that require repair.
48. Match the damage type or repair step at the left with a related enzyme at right. Only one answer will
be the most direct for each.
___ cytosine deamination (a) hypoxanthine-N-glycosylase
___ base loss (b) AP endonuclease
___ adenine deamination (c) mutH protein
___ binds to GATC sequences (d) DNA polymerase I
___ binds to mismatch in DNA (e) uracil N-glycosylase
Chapter 25 DNA Metabolism
300
___ DNA synthesis in gaps (f) mutS-mutL complex
___ seals nicks (g) ABC excinuclease
___ O6-methylguanine (h) DNA photolyase
___ direct chemical reversal (i) O6-methylguanine
of pyrimidine dimer formation methyltransferase
___ double-strand break (j) DNA ligase
___ excision of a lesion- (k)
integrase
containing oligonucleotide (l) RecA protein
(m) restriction endonuclease
49. Explain the role of DNA glycosylases in DNA repair.
50. Briefly explain the difference between base-excision repair and nucleotide-excision repair.
51. Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E. coli.
52. Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations?
Chapter 25 DNA Metabolism
301
53. Explain how inheriting mutations in genes encoding DNA repair enzymes could lead to increased
cancer risk.
54. Outline the four key features of the current model for homologous recombination during meiosis in a
eukaryotic cell.
55. Outline the key steps that occur during meiosis in animal germ-line cells.
Ans: The chromosomes of a diploid cell are duplicated so that each cell now contains four copies of
56. Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.
57. Name the three possible outcomes or consequences (at the DNA level) of a site-specific
Chapter 25 DNA Metabolism
302
recombination event. For each of these, explain concisely (in one sentence) how the relative location
and orientation of the recombination sites determines the outcome of the recombination event. Do
not describe specific examples of site-specific recombination systems.
58. What distinguishes the simple from the complex class of bacterial transposon?
59. What distinguishes the two mechanistic pathways for transposition in bacteria, and what is a
cointegrate?
60. Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.