Chapter 26 RNA Metabolism
Multiple Choice Questions
1. RNA polymerase:
A) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed.
B) can synthesize RNA chains without a primer.
C) has a subunit called
(lambda), which acts as a proofreading ribonuclease.
D) separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then
copies one of them.
E) synthesizes RNA chains in the 3‘ → 5‘ direction.
2. Which of the following statements about E. coli RNA polymerase is false?
A) Core enzyme selectively binds promoter regions, but cannot initiate synthesis without a sigma
factor.
B) RNA polymerase holoenzyme has several subunits.
C) RNA produced by this enzyme will be completely complementary to the DNA template.
D) The enzyme adds nucleotides to the 3‘ end of the growing RNA chain.
E) The enzyme cannot synthesize RNA in the absence of DNA.
3. Which of the following statements about E. coli RNA polymerase (core enzyme) is false?
A) In the absence of the subunit, core polymerase has little specificity for where initiation begins.
B) The core enzyme contains several different subunits.
C) The core enzyme has no polymerizing activity until the subunit is bound.
D) The RNA chain grows in a 5‘ → 3‘ direction.
E) The RNA product is complementary to the DNA template.
4. RNA polymerase from E. coli (core enzyme alone) has all of the following properties except that it:
A) can extend an RNA chain and initiate a new chain.
B) is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
C) produces an RNA polymer that begins with a 5‘–triphosphate.
D) recognizes specific start signals in DNA.
E) requires all four ribonucleoside triphosphates and a DNA template.
Chapter 26 RNA Metabolism
302
5. The sigma factor of E. coli RNA polymerase:
A) associates with the promoter before binding core enzyme.
B) combines with the core enzyme to confer specific binding to a promoter.
C) is inseparable from the core enzyme.
D) is required for termination of an RNA chain.
E) will catalyze synthesis of RNA from both DNA template strands in the absence of the core
enzyme.
6. After binding by E. coli RNA polymerase, the correct order of events for transcription initiation is:
A) closed complex formation, open complex formation, promoter clearance, start of RNA synthesis.
B) closed complex formation, open complex formation, start of RNA synthesis, promoter clearance.
C) open complex formation, closed complex formation, start of RNA synthesis, promoter clearance.
D) start of RNA synthesis, closed complex formation, open complex formation, promoter clearance.
E) start of RNA synthesis, open complex formation, closed complex formation, promoter clearance.
7. Which one of the following statements about E. coli RNA polymerase (core enzyme) is false?
A) It can start new chains de novo or elongate old ones.
B) It has no catalytic activity unless the sigma factor is bound.
C) It uses nucleoside 5‘-triphosphates as substrates.
D) Its activity is blocked by rifampicin.
E) Its RNA product will hybridize with the DNA template.
8. “Footprinting,” or DNase protection, is a technique used to identify:
A) a region of DNA that has been damaged by mutation.
B) E. coli cells that contain a desired, cloned piece of DNA.
C) the position of a particular gene of a chromosome.
D) the position of internally double-stranded regions in a single-stranded DNA molecule.
E) the specific binding site of a repressor, polymerase, or other protein on the DNA.
9. Which of the following is (are) characteristic of
-independent termination of RNA transcription in E.
coli?
Chapter 26 RNA Metabolism
303
A) The RNA transcript contains self-complementary sequences.
B) Three conserved A’s in the template strand near the end of the transcript.
C) A CA-rich sequence near the end of the transcript.
D) Both A and B
E) Both A and C
10. Which of the following is not a characteristic of the
-terminator in E. coli?
A) The
-terminator has an ATP-dependent RNA-DNA helicase activity.
B) The
-terminator migrates in the 3‘-5‘ direction along RNA.
C) The
-terminator causes RNA polymerase release at a CA-rich sequence near the end of the
transcript.
D) ATP is hydrolyzed by the
-terminator during the termination process.
E) All of the above are characteristics of the
-terminator.
11. Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II?
A) DNA helicase activity
B) DNA polymerase activity
C) Formation of an open complex
D) Protein binding to specific DNA sequences
E) Protein phosphorylation
12. Which of the following is not a known function of TFIIH?
A) DNA helicase activity.
B) Hydrolysis of ATP.
C) Formation of an open complex
D) Termination of transcription
E) Nucleotide excision repair
13. Processing of a primary mRNA transcript in a eukaryotic cell does not normally involve:
A) attachment of a long poly(A) sequence at the 3‘ end.
B) conversion of normal bases to modified bases, such as inosine and pseudouridine.
C) excision of intervening sequences (introns).
D) joining of exons.
E) methylation of one or more guanine nucleotides at the 5‘ end.
Chapter 26 RNA Metabolism
304
14. The 5‘-terminal cap structure of eukaryotic mRNAs is a(n):
A) 7-methylcytosine joined to the mRNA via a 2‘,3‘-cyclic linkage.
B) 7-methylguanosine joined to the mRNA via a 5‘ → 3‘ diphosphate linkage.
C) 7-methylguanosine joined to the mRNA via a 5‘ → 5‘ triphosphate linkage.
D) N6-methyladenosine joined to the mRNA via a 5‘ → 5‘ phosphodiester bond.
E) O6-methylguanosine joined to the mRNA via a 5‘ → 5‘ triphosphate linkage.
15. The excision (splicing) of many group I introns requires, in addition to the primary transcript RNA:
A) a cytosine nucleoside or nucleotide and a protein enzyme.
B) a guanine nucleoside or nucleotide (only).
C) a protein enzyme only.
D) a small nuclear RNA and a protein enzyme.
E) ATP, NAD, and a protein enzyme.
16. A branched (“lariat”) structure is formed during:
A) attachment of a 5‘ cap to mRNA.
B) attachment of poly(A) tails to mRNA.
C) processing of preribosomal RNA.
D) splicing of all classes of introns.
E) splicing of group II introns.
17. Splicing of introns in nuclear mRNA primary transcripts requires:
A) a guanine nucleoside or nucleotide.
B) endoribonucleases.
C) polynucleotide phosphorylase.
D) RNA polymerase II.
E) small nuclear ribonucleoproteins (snRNPs).
18. Which one of the following is not true of the mRNA for calcitonin?
Chapter 26 RNA Metabolism
305
A) Exons are used for polypeptide synthesis.
B) Introns are complementary to their adjacent exons and will form hybrids with them.
C) The mature mRNA is substantially shorter than the corresponding region on the DNA.
D) The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm.
E) The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary
transcript.
19. Differential RNA processing may result in:
A) a shift in the ratio of mRNA produced from two adjacent genes.
B) attachment of the poly(A) tail to the 5‘ end of an mRNA.
C) inversion of certain exons in the final mRNA.
D) the production of the same protein from two different genes.
E) the production of two distinct proteins from a single gene.
20. Which of the following statements about the synthesis of rRNA and tRNA in E. coli is true?
A) Both rRNA and some tRNAs are part of the same primary transcript.
B) Each rRNA sequence (16S, 23S, 5S) is transcribed as a separate primary transcript.
C) Primary tRNA transcripts undergo methylation, but rRNA sequences are not methylated.
D) The tRNA sequences all lie at the 3’end of the rRNA transcripts.
E) There is a single copy of the rRNA genes.
21. Which of the following is not involved in mRNA processing in vertebrates?
A) 30S pre-rRNA
B) The nucleoleus
C) Ribonucleases
D) snoRNAs.
E) snoRNPs
22. Which of the following is not a post-transcriptional modification in mRNA or tRNA?
A) 4-thiouridine
B) Pseudouridine
C) Dihydrouridine
D) Ribouridine
E) Ribothymidine
Chapter 26 RNA Metabolism
306
23. Which of the following is not part of miRNA formation?
A) Pri-miRNA
B) Pre-miRNA
C) Dicer
D) RISC
E) Pseudouridine
24. Which of the following is not usually essential for the catalytic activity of ribozymes?
A) Correct base pairing
B) Correct base sequence
C) Correct interaction with protein
D) Correct secondary structure
E) Correct three-dimensional structure
25. Which one of the following properties of the L-19 IVS ribozyme is not shared with enzymes that are
purely protein?
A) It acts as a true catalyst.
B) It can be competitively inhibited.
C) It displays Michaelis-Menten kinetics.
D) It exploits base pairing with internal guide sequences.
E) It makes use of covalent and metal ion catalysis.
26. Which one of the following statements about mRNA stability is true?
A) Degradation always proceeds in the 5‘ to 3‘ direction.
B) Degradation of mRNA by polynucleotide phosphorylase yields 5‘–nucleoside monophosphates.
C) In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs.
D) Rates of mRNA degradation are always at least 10-fold slower than rates of mRNA synthesis.
E) Secondary structure in mRNA (hairpins, for example) slows the rate of degradation.
27. The reverse transcriptase of an animal RNA virus catalyzes:
A) degradation of the RNA strand in a DNA-RNA hybrid.
Chapter 26 RNA Metabolism
307
B) insertion of the viral genome into a chromosome of the host (animal) cell.
C) RNA formation in the 3‘ → 5‘ direction.
D) RNA synthesis, but not DNA synthesis.
E) synthesis of an antisense RNA transcript.
28. Reverse transcriptase:
A) can utilize only RNA templates.
B) has a 3‘ → 5‘ proofreading exonuclease but not a 5‘ → 3‘ exonuclease.
C) is activated by AZT.
D) is encoded by retroviruses.
E) synthesizes DNA with the same fidelity as a typical DNA polymerase.
29. Compared with DNA polymerase, reverse transcriptase:
A) does not require a primer to initiate synthesis.
B) introduces no errors into genetic material because it synthesizes RNA, not DNA.
C) makes fewer errors in synthesizing a complementary polynucleotide.
D) makes more errors because it lacks the 3‘ → 5‘ proofreading exonuclease activity.
E) synthesizes complementary strands in the opposite direction⎯from 3‘ → 5‘.
30. AZT (3‘-azido-2‘,3‘-dideoxythymidine), used to treat HIV infection, acts in HIV-infected cells by:
A) blocking ATP production.
B) blocking deoxynucleotide synthesis.
C) inhibiting reverse transcriptase.
D) inhibiting RNA polymerase II.
E) inhibiting RNA processing.
31. Which of the following is not true about telomerase?
A) Telomerase is a reverse transcriptase.
B) Telomerase utilizes a tRNA template.
C) The primer for telomerase is the 3‘-end of the DNA chromosomes.
D) Telomerase synthesizes DNA in the 5‘ → 3‘ direction.
E) Telomerase consists of both RNA and protein.
Chapter 26 RNA Metabolism
308
32. Which one of the following statements about the reverse transcriptases of retroviruses and the RNA
replicases of other single-stranded RNA viruses, such as R17 and influenza virus, is correct?
A) Both enzymes can synthesize either RNA or DNA from an RNA template strand.
B) Both enzymes can utilize DNA in addition to RNA as a template strand.
C) Both enzymes carry the specificity for the RNA of their own virus.
D) Both enzymes have error rates similar to those of cellular RNA polymerases.
E) Both enzymes require host-encoded subunits for their replication function.
33. Aptamers are:
A) double-stranded RNA products of nuclease action on hairpin RNAs.
B) repeat sequence elements at the ends of transposons.
C) small RNA molecules selected for tight binding to specific molecular targets.
D) the RNA primers required for retroviral replication.
E) the short tandem repeat units found in telomeres.
34. Which of these polymerases does not require a template?
A) RNA pol I
B) RNA pol II
C) Reverse transcriptase
D) Polyadenylate polymerase
E) RNA replicase
Short Answer Questions
35. Consider the following small hypothetical gene. The DNA bases corresponding to the first and last
mRNA nucleotides are indicated by a “+” and a “*,” respectively. Give the sequence(s) of the mRNA
strand(s) produced by this gene.
+ *
5’–GGCTATGTACGTAGCTACGTA-3’
|||||||||||||||||||||
3’–CCGATACATGCATCGATGCAT-5’
Chapter 26 RNA Metabolism
309
36. Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having
the sequence: (5‘)ATCGTACCGTTA(3‘)
37. List one basic property that distinguishes RNA polymerases from DNA polymerases, and list one
basic property they share.
38. Below, an RNA molecule is being transcribed from a strand of DNA. Indicate the 5‘ and 3‘ ends of
the RNA molecule and of the strand of DNA that is complementary to the RNA molecule. In which
direction is synthesis occurring?
Chapter 26 RNA Metabolism
310
39. For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an
E if the statement applies only to eukaryotes, and an E and P if the statement applies to both
eukaryotes and prokaryotes.
___ RNA synthesis is blocked by actinomycin D.
___ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA.
___ Transcription of mRNA is blocked by
-amanitin.
___ Sigma (
) subunit detaches from RNA polymerase shortly after transcription has initiated.
___ The 5‘ end of the mature mRNA begins with a triphosphate.
___ The primary mRNA transcript is inactive.
___ Termination of transcription requires the protein
factor.
40. The specific sequences that E. coli RNA polymerase usually binds to in E. coli DNA before initiating
transcription generally contain more A=T base pairs than GC base pairs. In no more than a few
sentences, speculate on why this might be the case.
41. Describe the sequence of events in the initiation of transcription by E. coli RNA polymerase.
42. In a
-independent terminator, there is a palindrome rich in GC base pairs, followed by 8–10 uridine
residues. Explain how each of the following changes might affect terminator function: (a)
substitution of cytidines for the 8–10 uridines; (b) mutations in the palindrome that decrease its GC
content; (c) elimination of half of the palindromic sequence.
Chapter 26 RNA Metabolism
311
43. Compare and contrast
-dependent and
-independent termination of transcription in prokaryotes.
44. The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5‘
end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below,
there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site
for protein X.
*(5‘)GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC
[
45. Describe briefly the process of initiation by eukaryotic RNA polymerase.
Chapter 26 RNA Metabolism
312
46. Indicate whether each of the following statements about eukaryotic cells is true (T) or false (F).
___ They have three distinct RNA polymerases.
___ Their mRNAs are generally synthesized by RNA polymerase I.
___ RNA polymerase III synthesizes only rRNAs.
___ The 5S rRNA is synthesized by RNA polymerase I
___ Their RNA polymerases initiate transcription at specific promoter sites on the DNA
47. Rifampicin blocks RNA polymerase; why would this be lethal to a cell that was sensitive to this
drug?
48. Name four general types of posttranscriptional processing reactions that are observed in RNA.
Briefly (one sentence or less) point out an example of each type. In your example, identify the type
of RNA molecule involved (tRNA, mRNA, rRNA, etc.), the type of “processing” involved, and
whether the example is characteristic of eukaryotes or prokaryotes, or both. Do not describe specific
genes, sequences, complicated structures, or enzymes.
49. Describe in words (not using structures) the important features of the structures present on the 5‘ and
Chapter 26 RNA Metabolism
313
3‘ ends of mature (processed) eukaryotic mRNAs.
50. Describe the mechanistic difference that distinguishes the splicing of group I introns from that of
group II introns.
51. Describe the function of polyadenylate polymerase and name two properties that distinguish it from
normal cellular RNA polymerases.
52. Beginning with the primary transcript containing a tRNA sequence, describe the steps in the
formation of a mature tRNA molecule in E. coli.
53. In 1989, Sidney Altman won a Nobel Prize for his work on RNase P. In no more than three
sentences, describe the function of RNase P, as well as the unusual characteristic of this enzyme that
made Altman’s work so important.
Chapter 26 RNA Metabolism
314
54. Transfer RNAs have several bases in addition to the normal four found in RNA. How are these rare
bases incorporated into the tRNA molecule?
55. Define ribozymes and briefly describe the structure and function of two ribozymes.
56. Compare transcription and reverse transcription in terms of the following characteristics:
(a) Direction of polynucleotide synthesis
(b) Nature of template
(c) Nature of primer
(d) Incorporated nucleotides
57. Describe all of the known catalytic activities of reverse transcriptase.
58. What is a telomere? Describe the key features of its structure. What is unusual about the structure
Chapter 26 RNA Metabolism
315
and/or mechanism of action of telomerase?
59. Why did the “RNA World” hypothesis have to await the discovery of ribozymes in order to become a
widely attractive scenario?
60. What is the utility of the SELEX protocol and how does it work?