Archives

Treatment of dividing cells with a low dose of the antifungal drug benomyl, which destabilizes microtubules, slows down correct spindle assembly. But at such doses, the spindle is eventually formed and the cells survive. However, mutations in some genes confer […]

Everything else being equal, if the mean lifetime of a protein is doubled, its concentration at steady state would ___ A.increase approximately twofold. B.increase less than twofold. C.increase over twofold. D.decrease approximately twofold. E.decrease less than twofold. A virus ___ […]

Under anaerobic conditions, glycolysis provides most of the ATP that the cell needs. In animal cells, pyruvate, the end product of glycolysis, is converted to lactic acid by lactate dehydrogenase, as shown below: CH3(CO)COO– + X –>CH3(CHOH)COO–+ Y What is […]

What determines the time and place that a certain gene is transcribed in the cell? A.The type of cis-regulatory sequences associated with it B.The relative position of cis-regulatory sequences associated with it C.The arrangement of various cis-regulatory sequences associated with […]

The Dam methylase is responsible for methylating the adenine base in GATC sequences in Escherichia coli. Imagine two E. coli strains, one without any active Dam methylase, and the other with a hyperactive version of the enzyme that operates faster […]

Actin filaments that are held together by the cross-linking protein fimbrin are not contractile. This is probably because … A.the very weak cross-linking by this protein cannot convert myosin II activity into a coherent contraction. B.fimbrin arranges the actin filaments […]

In the following schematic graph of a hypothetical set of RNA-seq data, the number of reads is plotted for a region of chromosome containing two genes, from samples obtained from two different tissues. Which gene (X or Y) do you […]

If mice are injected with antibodies against selectin homing receptors or against the integrin ligand I-CAM1 (which is expressed on the surface of endothelial cells), they show immune defects, such as higher susceptibility to bacterial infections. Which of the following […]

These proteins are found in the budding yeast Saccharomyces cerevisiae; they form “neck filaments” between a mother cell and its growing bud, and help polarize protein distribution between the two. These proteins … A.can polymerize to form filaments and sheets. […]

After release into the synaptic cleft, the neurotransmitter dopamine is actively taken up by the cells via specific dopamine transporters. The drug cocaine interferes with this process and is therefore called a reuptake inhibitor. The inhibition of the transporter at […]

After an animal dies, its muscles start to stiffen before the decomposition of tissues relaxes the muscles again. Which of the following would you expect to explain this muscle stiffening (i.e. rigor mortis)? A.The myosin II heads in muscle fibers […]

In the following fate map for the Xenopus blastula, indicate which zone in the map (A to D) better corresponds to each of the following fates. Your answer would be a four-letter string composed of letters A to D only, […]

A neuron’s repetitive firing rate is limited by an absolute refractory period, during which a new action potential cannot be generated. Which event is chiefly responsible for this limit? A.Opening of K+ leak channels. B.Opening of voltage-gated Na+ channels. C.Opening […]

Type IV collagen molecules can interact at their C-termini to form dimers and at their N-termini to form tetramers. What category do you think this type of collagen belongs to? A.Fibrillar B.Fibril-associated C.Network-forming D.Proteoglycan core E.Anchorage fibril Carcinoma of the […]

Consider a cis-regulatory enhancer sequence in the Escherichia coli chromosome that is located thousands of nucleotide pairs upstream of the gene that it regulates. If the regulatory sequence is mutated to become nonfunctional, the introduction of the wild-type enhancer on […]

Which of the following is correct regarding aequorin? A.It is a small molecule used to detect calcium ions in vivo. B.It is a fluorescent dye. C.It emits blue light in the presence of calcium ions. D.It can be used in […]

Skeletal muscle cells consume enormous amounts of ATP. From the following list, choose the two proteins that directly hydrolyze most of this ATP. Your answer would be a two-letter string composed of letters A to F only, in alphabetical order, […]

Chromosome 3 contains nearly 200 million nucleotide pairs of our genome. If this DNA molecule could be laid end to end, how long would it be? The distance between neighboring base pairs in DNA is typically around 0.34 nm. A.About […]

Among the following cancers, one is currently leading to the most number of deaths in the United States and in the rest of the world. In the United States, it contributes to cancer mortality more than the next three killing […]

Carcinoma cells that have acquired malignancy and started local invasiveness to begin metastasis … A.decrease the expression of E-cadherin and undergo mesenchymal-epithelial transition. B.increase the expression of E-cadherin and undergo mesenchymal-epithelial transition. C.decrease the expression of E-cadherin and undergo epithelial-mesenchymal […]

An amino acid residue that is not part of the active site of an enzyme and does not interact with the ligand is nevertheless critical for ligand binding and is highly conserved. How can this be explained? A.This residue is […]

Cofilin binds preferentially to ADP-containing actin filaments rather than to ATP-containing filaments. Consequently, this protein … A.competes with profilin for actin binding. B.binds to older actin filaments. C.binds to the plus end of actin filaments. D.stabilizes actin filaments. E.All of […]

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other. A.5’___ UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU___3′ B.5’___ UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU___3′ C.5’___ […]

Which of the following is NOT true regarding vertebrate segmentation? A.The presomitic mesoderm retreats tailward as new somites are generated. B.The period of gene-expression oscillations in the presomitic mesoderm determines the size of each somite. C.If feedback delays in the […]

This family of ATPases is structurally related to the turbine-like pumps that acidify lysosomes and vesicles; however, they usually function in reverse, generating ATP from ADP and Pi using proton gradients across membranes. What are they called? A.P-type pumps B.ABC […]

It is a model organism used to study various eukaryotic cell and developmental processes such as cell division and cell death. Its hermaphrodite adult is composed of exactly 959 somatic (non-germ) cells, the lineage of each of which has been […]

Nucleosomes that are positioned like beads on a string over a region of DNA can interact to form higher orders of chromatin structure. Which of the following factors can contribute to the formation of the 30-nm chromatin fiber from these […]

In assembling a nucleosome, normally the ___(1) histone dimers first combine to form a tetramer, which then further combines with two ___ (2) histone dimers to form the octamer. A.1: H1-H3; 2: H2A-H2B B.1: H3-H4; 2: H2A-H2B C.1: H2A-H2B; 2: […]

Lampbrush chromosomes ___ A.are transcriptionally inactive. B.are readily observed in the oocytes of humans and insects. C.have thousands of duplicated DNA molecules arranged side by side. D.are mitotic chromosomes with two sister chromatids attached together only at the centromere. E.are […]

Cyclin B1, a key cell cycle regulatory protein in vertebrates, is mostly cytosolic before mitosis. Early in mitosis, however, the protein is phosphorylated by certain protein kinases and consequently accumulates in the nucleus. How can phosphorylation bring about nuclear accumulation […]

Using Cre recombination, the gene encoding stem cell factor (SCF) can be deleted in specific cell types in adult mice. Deletion of this gene in which of the following cells would you expect to lead to the most significant depletion […]

In contrast to a primary immune response, a secondary immune response generally … A.has a longer lag period. B.is stronger. C.involves induction of effector cells to become memory cells. D.takes longer to develop. E.All of the above. The compound GDPNP […]

You have grown neurons in a culture dish containing laminin and have induced axon outgrowth. You now incubate the cells in the presence of various concentrations of two secreted proteins (1 and 2). You then fix the cells, stain them […]

Which of the following molecules is capable of tension-sensing by exposing binding sites for other proteins when mechanically stretched? A. -Catenin B.Talin C.Fibronectin D.All of the above Which of the following drugs is toxic for our cells? A.Cytochalasin B, which […]

Indicate which of the following enzymatic activities corresponds to A, B, or C in the following schematic drawing of DNA methylation events in the human genome. Your answer would be a three-letter string composed of letters A, B, and C […]

Which of the following is a primary pathogen? A.Staphylococcus aureus B.Streptococcus pneumoniae C.Yersinia pestis D.Papillomavirus E.MRSA (methicillin-resistant S. aureus) Which of the following is true about the molecule shown in the following drawing? A.Its gene is transcribed by RNA polymerase […]

You have transfected HeLa cells with a gene encoding the human immunodeficiency virus (HIV) protein Rev and have induced the expression of the protein. You incubate the cell culture in the presence or absence of leptomycin B and later measure […]

Formin nucleates the growth of parallel actin bundles in the cell. Additionally, myosin motor activity is positively regulated by phosphorylation. The monomeric G protein RhoA is important in cytokinesis, because it directly or indirectly … A.activates formins and inactivates myosin […]

A researcher studying the human immunodeficiency virus (HIV) has infected human T cells with wild-type or Rev-deficient viruses. She extracts cytoplasmic RNA from the cells and separates each isolated RNA mixture by agarose-gel electrophoresis. She then uses northern analysis using […]

The chemical compound PMA is a potent stimulator of the epithelial-mesenchymal transition in epithelial cells. The activity of two of the following types of proteins is typically up-regulated in epithelial cells treated with PMA, while that of the other two […]

Which of the following can be a function for intrinsically disordered protein sequences? A.High-specificity binding to other proteins B.Cell signaling through covalent modification of the protein sequence C.Tethering to hold interacting proteins in close proximity D.Formation of a diffusion barrier […]

Which of the following actin-binding proteins cannot bind to the same actin filament simultaneously? A.Gelsolin and tropomodulin B.Tropomyosin and tropomodulin C.Profilin and tropomodulin D.Cofilin and CapZ E.Formin and CapZ This protein folds into a doughnut shape that can encircle DNA. […]

The GM progenitor cell gives rise to two main classes of white blood cells in the presence of appropriate colony-stimulating factors. Both of these cell types … A.have relatively long half-lives, being capable of living for months if not years. […]

Indicate if each of the following descriptions matches actin filaments (A), microtubules (M), or intermediate filaments (I). Your answer would be a four-letter string composed of letters A, M, and I only; e.g. AAMM. ( )They form hollow structures with […]

Sort the following steps in the order that they normally happen during the process of repairing double-strand breaks by homologous recombination. Your answer would be a six-letter string composed of letters A to F only, e.g. DEFABC. (A)Ligation (B)DNA synthesis […]

If an average globular protein was of the size of a tennis ball, a typical animal cell would be as large as ___ A.a cubicle. B.a room. C.a tennis court. D.a stadium. E.a city. Indicate whether each of the following […]

Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily distinguished in electron micrographs of chromatin spreads. They have a characteristic “Christmas tree” appearance, where the DNA template is the “trunk” of the tree and the […]

The duty ratio for a motor protein is defined as the fraction of time in each cycle of activity of the motor in which the head is bound with high affinity to its cytoskeletal track. Which of the following is […]

Gene duplication can give rise to homologous genes that are part of gene families. For example, there are six actin genes in the genome of most mammalian species. In humans, the ACTB gene, which encodes a cytoskeletal actin, is expressed […]

How is tRNA splicing different from mRNA splicing in eukaryotic cells? A.tRNA splicing does not proceed via transesterification reactions. B.tRNA splicing is carried out by proteins only. C.tRNA splicing does not create a lariat intermediate. D.tRNA splicing involves RNA endonuclease […]

Why do liposomes not fuse with one another spontaneously when suspended in an aqueous environment? A.Because fusion requires a large number of flip-flops, which are very rare. B.Because the hydration shell of the polar head groups of the lipids needs […]

Why do liposomes not fuse with one another spontaneously when suspended in an aqueous environment? A.Because fusion requires a large number of flip-flops, which are very rare. B.Because the hydration shell of the polar head groups of the lipids needs […]

To enter the host cell, intracellular bacterial pathogens can induce phagocytosis in cells that are normally nonphagocytic. This is done by two major mechanisms depicted in the following schematic diagrams (A and B). Indicate whether each of the following descriptions […]

What do all -barrel transmembrane proteins have in common? A.The number of strands. B.The diameter of the barrel. C.The number of negative peaks in their hydropathy plots. D.The general function, i.e. membrane transport. E.The structural rigidity compared to -helical transmembrane […]

The marking of a protein by polyubiquitylation to signify degradation ___ A.requires the hydrolysis of one ATP molecule to ADP per polyubiquitin chain. B.involves covalent attachment of the target protein to the E1 enzyme. C.is carried out by the proteasome […]