Which of the following is a primary pathogen?
A.Staphylococcus aureus
B.Streptococcus pneumoniae
C.Yersinia pestis
D.Papillomavirus
E.MRSA (methicillin-resistant S. aureus)
Which of the following is true about the molecule shown in the following drawing?
A.Its gene is transcribed by RNA polymerase I.
B.There are about 50 genes in our genome encoding this type of molecule.
C.This molecule normally undergoes various covalent modifications.
D.It is normally composed of about 20 monomers.
E.Its gene transcript normally undergoes alternative splicing.
The transcript for which of the following noncoding RNA in our cells is expected to
undergo 5′ cap addition after transcription?
A.5S rRNA
B.miR-21 (a microRNA)
C.tRNAPhe
D.5.8S rRNA
E.18S rRNA
A mutation in the cdc28 gene in the budding yeast Saccharomyces cerevisiae causes
cell-cycle arrest, giving rise to unbudded cells that look like “dumbbells.” Treatment of
wild-type cells with nocodazole, a drug that destabilizes some cytoskeletal polymers,
leads to a similar phenotype. Based only on these observations, which statement is true
regarding cdc28?
A.cdc28 codes for a master regulatory kinase that phosphorylates other proteins.
B.Nocodazole binds to the protein coded by the cdc28 gene.
C.The product of the cdc28 gene is responsible for resistance to nocodazole.
D.The product of the cdc28 gene is involved in cell cycle regulation.
E.The product of cdc28 destabilizes the same cytoskeletal polymers that nocodazole
also destabilizes.
Imagine a small synthetic vesicle made from pure phospholipids enclosing an interior
lumen containing 1 mM glucose and 1 mM sodium chloride. If the vesicle is placed in
pure water, which of the following happens faster?
A.Na+ diffuses out.
B.Cl– diffuses out.
C.H2O diffuses in.
D.Glucose diffuses out.
E.Sodium chloride diffuses out.
Which of the following is NOT an anchoring junction?
A.Adherens junction
B.Desmosome
C.Actin-linked cell-matrix junction
D.Hemidesmosome
E.Tight junction
Sort the following organisms from the least to the most degree of asymmetry in the
unfertilized egg (i.e. pre-defined axes of polarization). Your answer would be a
three-letter string composed of letters A to C only, e.g. BCA.
(A)M. musculus
(B)D. melanogaster
(C)X. laevis
Which of the following statements is true regarding cellular metabolism?
A.A living organism decreases the entropy in its surroundings.
B.During catabolism, heat is generated, and the cell uses this heat to perform work
during anabolism.
C.The heat released by an animal cell as part of its metabolic processes comes from the
bond energies in the foodstuffs that are consumed by the animal.
D.Living organisms defy the second law of thermodynamics, but still obey the first law.
Lymphatic capillaries …
A.are lined with endothelial cells.
B.have leakier walls compared to blood capillaries.
C.can provide a path for cancer metastasis.
D.All of the above.
How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a
protein that has been tagged for degradation with a polyubiquitin chain?
A.None; the digestion does not require ATP hydrolysis and is exergonic
B.One
C.Two
D.Ten
E.Many; the number depends on the specific protein
Which of the following are recognized by pattern recognition receptors as
pathogen-associated molecular patterns?
A.Double-stranded viral RNAs
B.Formylmethionine-containing proteins
C.Unmethylated CpG motifs
D.Bacterial flagella components
E.All of the above
Which of the following stretches of amino acid residues would you expect to find in the
interior of protein molecules?
A.Ala-Asp-Asp-Tyr-Arg
B.Gly-Lys-Ser-Pro-Thr
C.Phe-Glu-Gln-Glu-Asn
D.Ala-Val-Leu-Ile-Trp
E.Gly-Tyr-His-Arg-His
In analysis using two-dimensional gel electrophoresis of the proteins expressed in
different cell types, the number of spots that are different in different cells usually
exceeds the number of common spots, and even the common spots can still have
different intensities. The spots representing which of the following proteins would you
expect to be among the common spots when compared across several cell types?
A.RPL10 (a ribosomal protein)
B.HBA1 (a hemoglobin subunit)
C.Insulin (a hormone)
D.Tyrosine aminotransferase (a metabolic enzyme)
E.All of the above
Consider the proteins Ras, Src, kinesin, and the ATP synthase pump. All of them ___
A.are allosteric proteins.
B.can have two or more distinct conformations.
C.can bind to ATP (or GTP).
D.can hydrolyze ATP to ADP (or GTP to GDP).
E.All of the above.
Two segments (S1 and S2) in a viral protein are suspected to be responsible for the
nuclear localization of the protein in infected human cells. You have engineered a
plasmid to encode the green fluorescent protein (GFP) fused to either or both of these
peptide segments, and have introduced the plasmid into the cells. After the expression
of the fusion protein is induced, you visualize the cells using a fluorescence microscope
equipped with filters appropriate for detection of GFP. Your results are presented in the
following schematic drawings in which the GFP signal is represented in green. Which
of the following is more consistent with these observations?
A.Both S1 and S2 are required for nuclear localization.
B.S1 is required and sufficient for nuclear localization.
C.S2 is required and sufficient for nuclear localization.
D.S1 is required but not sufficient for nuclear localization.
E.S2 is required but not sufficient for nuclear localization.
How are antibody-producing hybridoma cell lines immortalized to provide an unlimited
source of monoclonal antibodies?
A.By ectopic expression of telomerase
B.By transformation with a retrovirus
C.By cell fusion
D.By overproduction of introduced oncogenes
E.By irradiation
Indicate true (T) and false (F) statements below regarding the compartmentalization of
cells. Your answer would be a four-letter string composed of letters T and F only, e.g.
TTTF.
( )Almost all eukaryotic cells have plastids, but only plant cells have chloroplasts
capable of photosynthesis.
( )The perinuclear space is topologically equivalent to the extracellular space.
( )The mitochondria and chloroplasts are thought to have evolved by invagination and
pinching off from the plasma membrane of the ancient eukaryotic cell.
( )All organelles in a eukaryotic cell can be constructed de novo, which means that the
information to construct them is encoded in the genome.
For a simple enzymatic reaction that involves only one substrate and follows
Michaelis-Menten kinetics, the changes in the concentrations of substrate, product, free
enzyme, and the enzyme-substrate complex over the course of the reaction are depicted
by solid curves in the graph below. Which curve (1 to 4) corresponds to [ES]? Write
down the number as your answer.
For each of the following cartoon representations from left to right, indicate whether the
protein structure is composed of only helices (1), only parallel sheets (2), only
antiparallel sheets (3), helices plus parallel sheets (4), or ± helices plus
antiparallel sheets (5) as repetitive secondary structure elements. Your answer would
be a four-digit number composed of digits 1 to 5 only, e.g. 5513.
Images created in PyMOL, from PDB entries 1STU, 2LPC, 1SA8, and 3BOB.
Fill in the blank in the following paragraph regarding X-chromosome inactivation. Do
not use abbreviations.
“The presence of two copies of the X chromosome in females but only one in males
poses a potential problem for regulation of gene expression: everything else being
equal, the higher copy number of the X-linked genes can lead to an imbalanced
overproduction of their products in females compared to males. Organisms have
evolved different ___ mechanisms to solve this problem. In mammals, for example, the
almost complete inactivation of one of the X chromosomes provides the solution to the
dosage problem.”
Fill in the blank in the following paragraph regarding the extracellular matrix. Do not
use abbreviations.
“The extracellular matrix of connective tissues in animals is primarily made and
secreted by the … family of cells, although they may have more specific names in
certain tissues. Being common in connective tissues, these cells can also migrate and
proliferate if need be.”
A researcher has labeled the 5′ end of a DNA primer with 32P radioisotopes. The primer
can hybridize to a complementary sequence near the 3′ end of a long, spliced mRNA
molecule composed of three exons. The mRNA molecule can interact with two
RNA-binding proteins: one of them (protein 1) binds to the first exon and the other
(protein 2) binds to the second exon. The researcher uses reverse transcriptase to extend
the primer in the presence of the mRNA and either of these proteins, then separates the
cDNA products by gel electrophoresis, and finally visualizes the labeled DNA bands by
autoradiography. The results are presented schematically in the following drawing.
Assuming that the reverse transcriptase falls off the template when confronted by bound
proteins, which lane (A or B) in the gel corresponds to the reaction in the presence of
protein 1? Write down A or B as your answer.
The sequence of a region of DNA around the 5’end of a gene in Escherichia coli is
shown below. The -10 hexamer and the transcription start site are highlighted. What
would be the sequence of the first 10 nucleotides of the mRNA transcribed from this
gene? Write down the sequence from 5’to 3′, e.g. CGGAUAAACT.
5’€¦GCGCTTGGTATAATCGCTGGGGGTCAAAGAT€¦3′
Indicate true (T) and false (F) statements below regarding cytokinesis in eukaryotic
cells. Your answer would be a four-letter string composed of letters T and F only, e.g.
TFFF.
( )The preprophase band, composed of microtubules and actin filaments, marks the site
of cytokinesis in plant cells.
( )In some cell types, the site of contractile-ring formation is determined before mitosis.
( )The early cell plate in dividing plant cells appears after phragmoplast formation.
( )The membrane required for the newly formed cell plate in plant cells is provided by
endocytosis from the equatorial plasma membrane.