For the bacterial transcription machinery, which of the following mRNA sequences
would you expect to constitute a potent transcriptional termination signal? Note that the
two underlined regions in each sequence are complementary to each other.
A.5’___ UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU___3′
B.5’___ UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU___3′
C.5’___ UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA___3′
D.5’___ CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA___3′
Blood-group compatibility is an important consideration in red blood cell transfusions
that are administered in millions of liters worldwide every year. In the ABO
blood-group system, individuals with AB blood type are the universal recipient (can
accept blood from any donor), while those with O type are universal donors. If an
incompatible transfusion is made between an A-type (donor) and a B-type (recipient)
individual, for example, the anti-A antibodies present in the recipient’s plasma would
rapidly destroy the transfused blood cells with the help of the complement system, with
potentially serious consequences. But why do we produce antibodies against other
blood-group antigens even without having been exposed to those foreign blood cells
before? It has been suggested that these antibodies are generated in response to minor
infections (in early life) with microbes of the normal flora of our bodies, and that, in
addition to binding to the microbial antigens, these antibodies can cross-react with the
similar A- and B-type carbohydrate antigens of the ABO blood-group system. If this is
indeed the case, blood plasma from a “germ-free” individual would react with €¦
A.blood of any ABO type.
B.blood of no other ABO type.
C.blood from O-type individuals only.
D.blood from non-O-type individuals only.
E.blood from AB-type individuals only.
How is Cdc20-APC/C similar to Cdh1-APC/C?
A.They are both active throughout interphase.
B.They are both inhibited by M-Cdk.
C.They both inhibit M-Cdk activity.
D.They are both activated suddenly at the onset of mitosis.
E.They are both inactivated soon after anaphase.
Sort the following primary axes in the order that they are established during the
development of Xenopus laevis. Your answer would be a three-letter string composed
of letters A to C only, e.g. ACB.
(A)A-P
(B)D-V
(C)A-V
The transcription regulator AIRE (autoimmune regulator) plays a key role in developing
immunological self-tolerance by promoting the production of various cellular proteins
that are mainly expressed outside the thymus. Which of the following cells have the
highest level of AIRE?
A.Double-negative thymocytes
B.Double-positive thymocytes
C.Lymphoid follicle cells in lymph nodes
D.Thymus epithelial cells
E.Peyer’s patch cells
DNA ligases are used in both DNA replication and repair to seal breaks in the DNA.
But DNA damage can result in single- or double-strand breaks that are not normal
ligase substrates. These need to be processed first before a ligase can act on them. One
of the enzymes that is recruited to some of such breaks is called PNK. It has two
separate activities on the DNA, both of which can help provide a canonical ligase
substrate. Which of the following activities would you expect PNK to have in this
context?
A.5′ kinase (phosphorylation of a free 5′-OH group) and 3′ kinase
B.5′ phosphatase (dephosphorylation to create a free 5′-OH group) and 3′ phosphatase
C.3′ kinase and 3′ phosphatase
D.5′ phosphatase and 3′ kinase
E.5′ kinase and 3′ phosphatase
Several mechanisms contribute to the diversity of the mRNAs and proteins encoded by
a single gene in our genome. Which of the following is normally NOT one of them?
A.Alternative choice of polyadenylation sites
B.Alternative choice of translation initiation sites
C.Alternative choice of transcription initiation sites
D.Alternative choice of the reading frames
E.Alternative choice of splice sites
DNA-only transposons ___
A.can be recognized by the presence of short inverted repeats at each end.
B.often encode a transposase that mediates the transposition process.
C.leave double-strand breaks in the donor chromosome.
D.can move by a cut-and-paste mechanism.
E.All of the above.
Which of the following is NOT a likely ER signal sequence recognized by the
signal-recognition particle? All sequences are written with their N-terminus on the left.
A.Met-Lys-Leu-Ser-Leu-Val-Ala-Ala-Met-Leu-Leu-Leu-Leu-Ser-Ala-Ala-Arg-Ala
B.Met-Glu-Met-Phe-Gln-Gly-Leu-Leu-Leu-Leu-Leu-Leu-Leu-Leu-Ser-Met-Gly-Gly-T
hr-Trp-Ala
C.Met-Lys-Ala-Lys-Leu-Leu-Val-Leu-Leu-Tyr-Ala-Phe-Val-Ala-Gly-Asn
D.Met-Met-Ala-Ala-Gly-Pro-Arg-Thr-Ser-Leu-Leu-Leu-Ala-Phe-Ala-Leu-Leu-Cys-Le
u-Pro-Trp-Thr-Gln-Val-Val
E.Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile-Arg-Phe-Phe-Lys-Pro-Ala-Thr-Arg-Thr-Leu-Ser-S
er-Arg-Tyr-Leu
Most DNA tumor viruses inhibit the products of …
A.Apc and Rb
B.Brca1 and Rb
C.p53 and Rb
D.Brca1 and Apc
E.Brca1 and p53
Which of the following events occurs at the onset of S phase in a mitogen-stimulated
vertebrate cell?
A.Activation of Cdh1-APC/C
B.Activation of Rb
C.Activation of geminin
D.Activation of Cdc20
E.All of the above
You have identified an RNA-binding protein that can bind directly (with varying
affinities) to mRNA molecules that bear the following sequences near the 3′ splice sites
of their exons. Based on these results, what is the five-nucleotide consensus sequence
for the binding site of this protein? Your answer would be a five-letter string composed
of letters A, U, C, or G only; e.g. UUUAG.
Fill in the blank in the following paragraph describing collective cell rearrangements.
Do not use abbreviations.
“Cells form lamellipodia and attempt to crawl over one another, essentially pulling their
neighbors inward into a narrow zone. This is accompanied by elongation along the long
axis of the narrow zone. This process of … depends on Wnt signaling and is observed
multiple times during the development of a vertebrate.”
BrdU (bromodeoxyuridine) is a thymidine analog that can be naturally incorporated
into DNA (in place of thymidine) and detected by specific anti-BrdU antibodies. In an
experiment to study the regeneration capabilities of Schmidtea mediterranea, you first
fed the worms with BrdU-containing food for 30 minutes. After two hours, you fixed
and incubated the worms with a fluorescently labeled anti-BrdU antibody, and observed
its tissues with a fluorescence microscope. The result was that some nuclei are labeled
with fluorescence while others are unlabeled. Would you expect to observe neoblasts
mostly among cells that have (Y) or have not (N) been labeled with fluorescence? Are
the neoblasts expected to be scattered throughout the body (S) or localized to a certain
region (L)? If you fixed the worms after a week, instead of two hours, would you
expect the number of nuclei with detectable fluorescence to increase (I), remain
unchanged (U), or decrease (D) compared to these results? Write down your answer as
a three-letter string, e.g. YSD.
Indicate which numbered feature (1 to 5) in the schematic drawing below of the DNA
double helix corresponds to each of the following. Your answer would be a five-digit
number composed of digits 1 to 5 only, e.g. 52431.
( )Hydrogen-bonding
( )Covalent linkage
( )Phosphate group
( )Nitrogen-containing base
( )Deoxyribose sugar
EDTA is a metal-ion “chelator” that is commonly used to lower the concentration of
free divalent cations in solution. In the lab, your friend has cultured a human cell line
on elastic membranes that have been coated with fibronectin and attached to a device
that can stretch the membrane. She has quantified the binding of talin to integrin under
different conditions, and has presented the results in the following schematic graph,
which shows the binding in the presence or absence of EDTA in the cell-culture
medium. Which experiment (A or B) do you think was performed in the presence of
EDTA? Write down A or B as your answer.