For the bacterial transcription machinery, which of the following mRNA sequences
would you expect to constitute a potent transcriptional termination signal? Note that the
two underlined regions in each sequence are complementary to each other.
A.5’___ UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU___3′
B.5’___ UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU___3′
C.5’___ UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA___3′
D.5’___ CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA___3′
Blood-group compatibility is an important consideration in red blood cell transfusions
that are administered in millions of liters worldwide every year. In the ABO
blood-group system, individuals with AB blood type are the universal recipient (can
accept blood from any donor), while those with O type are universal donors. If an
incompatible transfusion is made between an A-type (donor) and a B-type (recipient)
individual, for example, the anti-A antibodies present in the recipient’s plasma would
rapidly destroy the transfused blood cells with the help of the complement system, with
potentially serious consequences. But why do we produce antibodies against other
blood-group antigens even without having been exposed to those foreign blood cells
before? It has been suggested that these antibodies are generated in response to minor
infections (in early life) with microbes of the normal flora of our bodies, and that, in
addition to binding to the microbial antigens, these antibodies can cross-react with the
similar A- and B-type carbohydrate antigens of the ABO blood-group system. If this is
indeed the case, blood plasma from a “germ-free” individual would react with €¦
A.blood of any ABO type.
B.blood of no other ABO type.
C.blood from O-type individuals only.
D.blood from non-O-type individuals only.
E.blood from AB-type individuals only.
How is Cdc20-APC/C similar to Cdh1-APC/C?
A.They are both active throughout interphase.
B.They are both inhibited by M-Cdk.
C.They both inhibit M-Cdk activity.
D.They are both activated suddenly at the onset of mitosis.
E.They are both inactivated soon after anaphase.