Notes to Instructors
Chapter 20 Biotechnology
What is the focus of this activity?
Almost all students have heard of DNA technology and know that DNA typing (or
What is the particular activity designed to do?
Activity 20.1 How and why are genes cloned into recombinant DNA vectors?
This activity is designed to help students understand:
Activity 20.2 How can PCR be used to amplify specific genes?
This activity is designed to help students understand:
What misconceptions or difficulties can this activity reveal?
Activity 20.1
Students tend to encounter a number of difficulties, misconceptions, and missing
conceptions that become evident as they try to build a model to demonstrate how genes
can be cloned by incorporation into bacterial plasmids. Here are three possible problems:
1. The news media can help educate the public, but in some cases, it can also cause
confusion. Some students have been “convinced” by what they read that gene
2. If it hasn’t surfaced before this time, you may notice that some students have the
idea that the DNA in bacteria is single-stranded. This misconception often comes
3. Many students don’t understand how restriction enzymes “cut” DNA. It is helpful to
mention that the “cuts” are in the phosphate sugar backbone of the DNA molecule.
Activity 20.2
Though the overall process of PCR is not conceptually complex, it is difficult to visualize
without modeling or diagramming it. This exercise asks student to diagram what happens
Answers
Activity 20.1 How and why are genes cloned into recombinant
DNA vectors?
Develop a model to explain how a human gene can be cloned into a bacterial plasmid.
Your model should be a dynamic (working or active) representation of the events that
need to occur in order to
When you develop and explain your model, be sure to include definitions or descriptions
of the following terms and components:
restriction enzyme(s)
ligase
transformation
E. coli
Activity 20.1 137
Building the Model
Use chalk on a tabletop or a marker on a large sheet of paper to draw at least
two test tubes and an E. coli cell’s plasma membrane. The E. coli should have
a diameter of at least 12 inches. The test tubes should have a width of at least
Use your model to answer the questions.
1. Prior to recombinant gene technology, the insulin required to treat diabetes was
obtained from the pancreases of slaughtered farm animals. Because the insulin was
from other species, some humans developed immune responses or allergic reactions
to it. As recombinant gene technology advanced, researchers explored the possibility
of incorporating the human insulin gene into a plasmid that could be transformed
into E. coli. If this technology was successful, the E. coli would produce human
insulin that could be harvested from the bacterial culture medium.
Researchers first needed to isolate the gene for insulin. To do this, they isolated
mRNA (rather than DNA) from the beta cells of human pancreas tissue. Using
reverse transcriptase, they made double-stranded DNA molecules that were
complementary to the mRNA molecules they extracted from the pancreas cells.
a. Based on what you know about eukaryotic chromosomes and genes, why did
researchers choose to isolate mRNA rather than DNA?
Eukaryotic genes contain introns, which must be excised from any pre-mRNA
b. What further adjustments might researchers need to make in the DNA molecules
produced by reverse transcriptase before the molecules could be incorporated
into bacterial plasmids?
To incorporate the DNA molecules into the plasmid DNA, researchers would
138 Activity 20.1
Activity 20.2 139
c. Not all the DNA molecules produced by reverse transcription from pancreatic
mRNA contained the gene for insulin. Some contained other genes. What
mechanisms can be used to locate those bacterial colonies that picked up
plasmids containing any of the genes produced by reverse transcription from
pancreatic mRNAs?
Grow the bacteria on a medium containing an antibiotic and X-gal. The plasmid
selected has an antibiotic resistance gene on it and a lacZ gene. The restriction
d. What mechanisms can be used to locate bacterial colonies that picked up only
plasmids containing the insulin gene?
A replica plate or blot of these white colonies can be made (see Figure 20.7,
Activity 20.2 How can PCR be used to amplify specific genes?
1. Assume you are using PCR to make multiple copies of a gene (shaded in grey below).
DNA containing gene of interest:
140 Activity 20.2
On separate sheets of paper, describe the overall process and diagram the results
you would obtain for 1, 2 and 3 rounds of PCR replication using the primers,
ATGTT and CCATT.
(Note: For simplicity we are showing DNA primers that are only 5 bases in length. In
actual use, the DNA primers used are at least 17 bases long. This length is used to help
reduce the risk that the primer anneals with [base pairs with] anything other than the
specific segment of DNA to be amplified.)
The explanation and diagram should look something like the following:
c. This allows the DNA primers to anneal.
3TATAAAGACTTACAAATTTGTCCCCATTTTGC5
5ATGTT
CCATT 5
5ATATTTCTGAATGTTTAAACAGGGGTAAAACG3
d. and e. The Taq polymerase adds DNTPs to the open 3’ ends of the DNA primers.
3TATAAAGACTTACAAATTTGTCCCCATTTTGC5
5ATGTTTAAACAG 3
Activity 20.2 141
The products of the second cycle are:
3TATAAAGACTTACAAATTTGTCCCCATTTTGC5
5ATGTTTAAACAGGGGTAAAACG3
3TACAAATTTGTCCCCATT5
5ATGTTTAAACAGGGGTAAAACG3
g. In the third cycle, heat separates the double strands of DNA. The system is then
cooled to allow DNA primers to anneal, and the Taq polymerase produces the
following 8 products:
3TATAAAGACTTACAAATTTGTCCCCATTTTGC5
5ATGTT
2. PCR (polymerase chain reaction) is often used in forensics to amplify small amounts
of DNA found at crime scenes. The amplified DNA is then tested for differences in
RFLP (restriction fragment length polymorphisms) or STR (single tandem repeat)
lengths.
a. Explain what RFLPs and STRs are.
RFLPs (restriction fragment length polymorphisms) are defined as the different
restriction fragment patterns produced when DNA is cut using specified
b. How do STRs compare for unrelated individuals versus for closely related
individuals (for example, parent and child or brother and sister)?
STRs are genetically inherited. Therefore, since half of a child’s DNA comes
c. How reliable are these types of DNA fingerprinting for identifying individuals?
What factors affect their reliability?
Only a small portion of the DNA is selected for DNA fingerprinting. The specific
RFLP or STR sites on the DNA that are commonly used tend to be highly
142 Activity 20.2
1. Which of the following sequences (on one strand of a double stranded DNA
molecule) is likely to be a cleavage site for a restriction enzyme? Explain your
answer.
a. CGTACC
b. ATGTCG
c. GATATG
d. TGCGCA
2. After undergoing electrophoresis, the gel in the figure below shows the RFLP
analysis of DNA samples obtained from a crime scene. Bloodstains on a suspect’s
shirt (B) were analyzed and compared with blood from the victim (V) and from the
suspect (S). Are the bloodstains on the shirt from the victim or from the suspect?
Explain.
If you examine the lane that contains the blood stains, you can find bands that do not
Activity 20.2 143
20.2 Test Your Understanding
VS B