Campbell Biology: Concepts and Connections, 8e (Reece et al.)
Chapter 12 DNA Technology and Genomics
12.1 Multiple-Choice Questions
1) Biotechnology
A) is a modern scientific discipline that has existed for only a few decades.
B) is strictly concerned with the manipulation of DNA.
C) has been around since the dawn of civilization.
D) is generally considered more harmful than valuable to society.
2) When DNA from two sources is combined into one single piece of DNA, it is known as
A) cloned DNA.
B) recombinant DNA.
C) a vector.
D) a plasmid.
3) The production of multiple identical copies of gene-sized pieces of DNA defines
A) gene cloning.
B) transformation.
C) DNA technology.
D) genetic engineering.
4) In the process of human gene cloning using plasmids, the bacterial plasmid
A) is used as the vector.
B) is the source of the gene to be cloned.
C) is cultured inside the human cell, which contains the gene to be cloned.
D) is used to insert the human gene into the bacterial chromosome.
5) DNA ligase binds
A) recombinant DNA to transformed bacterial cells.
B) recombinant DNA to recombinant proteins.
C) nucleotides in the DNA backbone together.
D) nucleotide base pairs together.
6) When plasmids are used to produce a desired protein,
A) the plasmids are inserted into the bacterial chromosome.
B) the plasmids multiply and produce the protein outside of the bacterium.
C) the desired gene is inserted into the plasmid, and the plasmid is returned to the bacterium by
transformation.
D) the bacterial genome and plasmid are inserted into the genome of the cell containing the
desired gene (often the cell of a plant or animal).
7) ________ are a major source of restriction enzymes.
A) Plant cells
B) Human cells
C) Archaea cells
D) Bacterial cells
8) Restriction enzymes
A) facilitate nucleotide base pairing.
B) cut DNA at specific sites.
C) stop transcription and translation.
D) bind together strands of DNA.
9) Restriction enzymes specifically recognize and cut short sequences of DNA called
A) introns.
B) exons.
C) sticky ends.
D) restriction sites.
10) “Sticky ends” are
A) produced by the action of DNA ligase.
B) produced by PCR.
C) always long sequences of a single nucleotide.
D) DNA fragments with single-stranded ends.
11) The feature of “sticky ends” that makes them especially useful in DNA recombination is their
ability to
A) bind to DNA and thereby activate transcription.
B) bind to ribosomes and thereby activate translation.
C) form hydrogen-bonded base pairs with complementary single-stranded stretches of DNA.
D) allow plasmids to attach to the main bacterial chromosome.
12) After DNA fragments with matching sticky ends are temporarily joined by complementary
base pairing, the union can be made permanent by the “pasting” enzyme
A) DNA ligase.
B) DNA polymerase.
C) DNA helicase.
D) ATP methylase.
13) The ________ approach to gene cloning employs a mixture of fragments from the entire
genome of an organism and results in the production of thousands of different recombinant
plasmids.
A) shotgun
B) genetic engineering
C) restriction
D) cloning
14) Which of the following is the best definition of a genomic library?
A) a collection of cloned DNA fragments that includes some parts of organism’s genome
B) a collection of cloned DNA fragments that includes an organism’s entire genome
C) a collection of cloned DNA fragments that includes multiple organisms’ genomes
D) a collection of cloned DNA fragments that includes only exons from an organism’s genome
15) Genomic libraries can be constructed using either bacterial plasmids or what other vector?
A) ribosomes
B) tRNA
C) human chromosomes
D) bacteriophages
16) The enzyme that converts information stored in RNA to information stored in DNA is
A) DNA ligase.
B) reverse transcriptase.
C) a restriction enzyme.
D) RNA polymerase.
17) A cDNA library differs from a genomic library in that
A) the cDNA was constructed from introns only.
B) genomic libraries are only stored in bacterial cells.
C) cDNA libraries are more stable.
D) cDNA libraries only contain information from genes that have been transcribed.
18) An advantage of using reverse transcriptase to prepare a gene for cloning is that
A) reverse transcriptase is more efficient than RNA polymerase.
B) the resulting DNA strand will lack exons.
C) reverse transcriptase is more efficient than DNA polymerase.
D) the resulting DNA strand will lack introns.
19) A nucleic acid probe is
A) a virus that transfers DNA to a recipient cell.
B) a piece of radioactively labeled DNA that is used to locate a specific gene.
C) an enzyme that locates a specific restriction site on RNA.
D) a plasmid that recognizes a specific DNA sequence.
20) Which of the following statements about nucleic acid probes is false?
A) A nucleic acid probe is a double-stranded section of DNA.
B) A nucleic acid probe can be used to find a specific gene.
C) A nucleic acid probe binds to a complementary sequence in the gene of interest.
D) A nucleic acid probe is usually labeled with a radioactive isotope or fluorescent tag to help
identify its location.
21) The type of recombinant bacteria most often used to mass-produce genes is
A) Pseudomonas aeruginosa.
B) Agrobacterium tumefaciens.
C) Escherichia coli.
D) Saccharomyces cerevisiae.
22) The only cells that can correctly attach sugars to proteins to form glycoprotein products are
A) yeast cells.
B) E. coli cells.
C) mammalian cells.
D) algal cells.
23) The advantage of being able to clone the gene for human insulin is that
A) there are too few cows, pigs, and horses to provide an adequate supply of their insulin.
B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin.
C) cow, pig, or horse insulin cannot keep a diabetic alive for more than three months.
D) using human insulin increases the probability that, in the future, the person suffering from
diabetes can be weaned from a dependence on insulin.
24) A vaccine works by
A) inhibiting bacterial replication.
B) stimulating the immune system.
C) inhibiting viral replication.
D) preventing the translation of mRNA.
25) Which of the following statements about DNA technology is false?
A) DNA technology is now used to mass-produce human insulin.
B) DNA technology is now used to mass-produce human growth hormone.
C) DNA technology is now used to create cells that can identify and kill cancer cells.
D) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen.
26) Golden Rice is golden in color because it is rich in
A) vitamin A.
B) vitamin C.
C) beta-carotene.
D) chromium picolinate.
27) A transgenic animal is
A) an animal that is the first of its kind to bear a particular allele.
B) an animal in which a genetic defect has been corrected using recombinant DNA therapy.
C) an animal containing a gene from another organism, typically of another species.
D) an animal containing genes from three or more species.
28) Which of the following genetically modified organisms has not been developed by genetic
engineers (at least, not yet)?
A) transgenic rice with genes for milk proteins
B) transgenic salmon with a growth hormone gene that allows them to grow more quickly
C) transgenic corn with the gene for human insulin
D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids
29) Which of the following has not been a significant issue in the creation of genetically
modified (GM) organisms?
A) the fact that some plants carrying genes from other species might represent a threat to the
environment
B) the fact that GM organisms cannot be modified to prevent them from reproducing once they
pass beyond the experimental stage
C) the fact that rogue microbes might transfer dangerous genes into other organisms
D) the fact that the protein products of transplanted genes might lead to allergic reactions
30) In order for gene therapy to be permanent in the patient being treated,
A) the defective gene must first be removed from all somatic cells.
B) the normal gene must be added to the germ line cells.
C) the normal gene must first be treated with UV radiation to ensure noninfectivity.
D) the normal gene must be transferred to somatic cells that can continuously multiply.
31) Genetically modifying ________ cells may directly affect future generations.
A) bone marrow
B) somatic
C) gamete-forming
D) photoreceptor
32) What is the preferred name of the technique used to determine if DNA comes from a
particular individual?
A) DNA technology
B) DNA analysis
C) DNA profiling
D) DNA microarrays
33) If you commit a crime, you need to make sure that you do not leave even the smallest speck
of blood, hair, or other organic matter from your body. If you do, the DNA in this material can
be amplified by ________, subjected to genetic analysis, and used to identify you as the
perpetrator of the crime.
A) PCR
B) STR analysis
C) RFLP
D) restriction digests
34) The polymerase chain reaction relies upon unusual, heat-resistant ________ that were
isolated from bacteria living in hot springs.
A) DNA polymerases
B) phages
C) restriction enzymes
D) plasmids
35) Gel electrophoresis sorts DNA molecules on the basis of their
A) nucleotide sequence.
B) ability to bind to mRNA.
C) solubility in the gel.
D) size.
36) During the process of electrophoresis, the ________ functions like a molecular sieve,
separating the samples according to their size.
A) sample mixture
B) positively charged electrode
C) negatively charged electrode
D) agarose gel
37) Which of the following statements regarding repetitive DNA is false?
A) Repetitive DNA is usually found between genes.
B) Repetitive DNA is identical in all humans.
C) Repetitive DNA is usually repeated multiple times in the genome.
D) Repetitive DNA can show great variation among individuals.
38) What is the current standard tool used for DNA profiling by forensic scientists?
A) STR analysis
B) gene cloning
C) genetic engineering
D) RFLP analysis
39) What is the smallest number of cells needed to perform a successful DNA profile?
A) 1
B) 20
C) 200
D) 1,000
40) Which of the following pieces of evidence would be considered the best for establishing
biological relatedness?
A) birth certificates
B) pictures from family reunions
C) testimony from relatives
D) a very close match in the DNA profile
41) When genetic variation in one nucleotide is found in at least 1% of the population, it is
known as a
A) single nucleotide polymorphism.
B) short tandem repeat.
C) recombinant DNA molecule.
D) genomic library.
42) Which of the following statements about genome sequencing is false?
A) The genomes of nearly 7,000 species have been completely sequenced.
B) The first eukaryotic organism to have its genome sequenced was yeast.
C) Most of the genomes that have been sequenced to date are eukaryotes.
D) The genome of a mouse has been sequenced.
43) Which of the following statements about genomics is false?
A) The first complete genome to be sequenced was a prokaryote.
B) Whole sets of genes and their interactions are studied in the field of genomics.
C) Genes from different species that have analogous sequences suggest similar function.
D) DNA technology limits genomic studies to prokaryotes.
44) Approximately what percentage of human DNA is noncoding?
A) 49%
B) 79%
C) 98.5%
D) 99.9%
45) The type of repetitive DNA composed of sequences of large repeated units is often
associated with
A) tandem repeats.
B) transposable elements.
C) sex-linked genes.
D) transcription factors.
46) Segments of eukaryotic DNA that can move or be copied from one site to another in the
genome are called
A) exons.
B) plasmids.
C) transposable elements.
D) vectors.
47) Which of the following statements regarding DNA is false?
A) Long stretches of repetitive DNA are prominent at centromeres and ends of chromosomes.
B) Human and E. coli genomes contain approximately the same proportions of noncoding DNA.
C) Current estimates are that there about 21,000 genes in the human genome.
D) Telomeres seem to have a structural function.
48) Why is the whole-genome shotgun method currently the tool of choice for analyzing
genomes?
A) It is extremely accurate.
B) Multiple genomes can be analyzed simultaneously.
C) It is fast and inexpensive.
D) It is very labor-intensive.
49) Which of the following statements regarding proteomics is true?
A) Proteomics is the study of protein interaction within a cell.
B) Proteomics involves the complete analysis of the prokaryotes.
C) Proteomics is the systematic study of the full set of proteins encoded by a genome.
D) Proteomics and genomics allow scientists to study life in an ever-increasing reductive
approach.
50) The number of proteins in humans
A) is approximately equal to the number of genes.
B) cannot be determined because the human genome is too complex.
C) is less than half the number of genes.
D) is much greater than the number of genes.
51) Genome sequence analysis suggests that Neanderthals
A) never interbred with humans.
B) are more closely related to chimpanzees than humans.
C) at least sometimes had pale skin and red hair.
D) could not speak.
52) Approximately what percentage of the human genome is identical to that of a chimpanzee?
A) 50.0%
B) 62.3%
C) 92.0%
D) 98.8%
53) The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^)
indicates the cut site. Examine the DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA
molecule with SacI?
A) two
B) three
C) four
D) five
54) Researchers are trying to make a genetically modified (GM) pig that expresses bovine (cow)
growth hormone to make it grow bigger. They isolated the bovine growth hormone gene, cut it
and a plasmid with the same restriction enzyme, and mixed them together. They inserted the
mixture into pig zygotes, but only normal pigs, not GM pigs, grew. What did they likely do
wrong?
A) They are trying to make a GM animal, which is impossible.
B) They forgot to add DNA ligase after mixing the plasmid and gene together.
C) They should have used different restriction enzymes to cut the plasmid and the gene.
D) They forgot to use PCR and make multiple copies of the growth hormone gene.