Which group of fishes includes a lineage that migrated out of fresh water and adapted to
life on land?
A) ray-finned fishes
B) jawless fishes
C) lobe-finned fishes
D) cartilaginous fishes
The shared genetic code of all life on Earth is evidence that ________.
A) the genetic code arose relatively late in the history of life on Earth
B) DNA replication is error-free
C) all life shares a common ancestry
D) bacterial cells arose earlier than eukaryotic cells
The state of human gene therapy today is that ________.
A) the work that has been completed so far is purely theoretical, but some treatments
are in development
B) there have been a small number of successes, including with the disease SCID
C) human gene therapy is used routinely in the treatment of certain rare cancers
D) human gene therapy is used to treat a wide variety of conditions, including diabetes,
cancer, and bone marrow diseases
Anything that prevents ATP formation will most likely ________.
A) result in cell death
B) force the cell to rely on lipids for energy
C) force the cell to rely on ADP for energy
D) have no effect on the cell
What type of chemical bond joins the bases of complementary DNA strands?
A) ionic
B) covalent
C) hydrophilic
D) hydrogen
To study the effect of ambient (environmental) temperature on the metabolic rate of
animals, a scientist takes a small animal and puts it in a sealed chamber with oxygen.
The scientist measures the amount of oxygen used by the animal at different
temperatures. The temperatures selected are those that the animal normally encounters
in nature. The data from this experiment are in the table below.
At high temperatures this animal loses water rapidly. To prevent dehydration, this
animal’s nephrons should ________.
A) increase reabsorption
B) decrease reabsorption
C) increase secretion
D) decrease secretion
What part of the nervous system cushions the CNS and helps supply it with nutrients
and hormones, and carries away wastes?
A) cerebrospinal fluid
B) spinal cord
C) interneurons
D) the bones of the skull
Some companies that produce paper will also produce a by-product that is sold as a
binder (something that binds, or holds, things together). From which part of trees does
this by-product come?
A) leaves
B) mycorrhizae
C) lignin
D) stomata
In a hypotonic solution, a plant cell will ________.
A) undergo plasmolysis
B) become flaccid
C) burst
D) become turgid
In a eukaryotic cell an abnormal protein is binding to the promoter for a gene. Which of
the following processes will likely occur in this scenario?
A) Transcription factors will bind to enhancers.
B) Transcription factors will bind to the promoter.
C) The gene will be expressed normally.
D) RNA polymerase will bind to the promoter.
Please refer to the following art to answer the following questions.
In the ecosystem shown above, a toxin that accumulates in body tissues would have the
largest effect on ________.
A) corals that obtain their food from photosynthesizing dinoflagellates
B) herbivorous shrimp
C) fish that eat shrimp and other invertebrates
D) The toxin would affect all of these equally.
Please read the following paragraph and answer the following questions.
Amanda’s parents realized that her body was not developing properly about the time she
was 12 years old. She was shorter than most of her friends and was not going through
changes normally associated with female puberty. They took her to a doctor who
initially diagnosed Amanda with Turner Syndrome because of her physical features. He
ordered a karyotype that confirmed his diagnosis. Amanda was born with only one X
chromosome. Although there is no specific cure, the doctor was able to treat her and
correct some of the problems associated with the condition. For example, she received
growth hormone to improve her growth and estrogen to help her develop the physical
changes of puberty.
Amanda’s abnormal number of sex chromosomes resulted from ________.
A) independent assortment of chromosomes
B) crossing over
C) nondisjunction
D) random fertilization
The concept of a membrane as a fluid mosaic reflects the ability of ________.
A) phospholipids and most proteins to drift about in the plane of the membrane
B) phospholipids but not proteins to drift about in the plane of the membrane
C) most proteins but not phospholipids to drift about in the plane of the membrane
D) carbohydrates to drift into and out of the membrane structure
Which nutrients often limit the distribution and abundance of photosynthetic
organisms?
A) water and oxygen
B) nitrogen and phosphorus
C) carbon dioxide and nitrogen
D) water and carbon dioxide
When contracted, ________ prevents movement of chyme from the stomach to the
small intestine.
A) peristalsis
B) reverse peristalsis
C) the epiglottis
D) a sphincter
If seed production had never evolved, which organisms would be missing in today’s
landscape?
A) bryophytes and ferns
B) ferns and gymnosperms
C) gymnosperms and angiosperms
D) angiosperms and bryophytes
Examine the following figure. Which of these stages occur(s) in the cytoplasm?
A) glycolysis
B) citric acid cycle
C) glycolysis and citric acid cycle
D) citric acid cycle and electron transport
Examine the figure below. The initiation of transcription requires that enhancers bind to
________.
A) DNA
B) the promoter
C) transcription factors
D) RNA polymerase
Which of these is most likely to cause the development of a six-legged frog?
A) mutation of homeotic genes
B) binding of repressors to operons
C) a mutation in DNA polymerase that affects all cells
D) conversion of a proto-oncogene to an oncogene
The figure shows oogenesis. What is the function of the polar bodies that are produced
during oogenesis? They are a mechanism that allows for ________.
A) the shedding of excess cytoplasm during the production of a haploid ovum
B) the shedding of excess genetic material during the production of a haploid ovum
C) the shedding of excess mitochondria during the production of a haploid ovum
D) streamlining of the ovum so as to facilitate the penetration of an ovum by a sperm
If a cell’s lysosomes burst, the cell would ________.
A) shrivel
B) divide into two cells
C) digest itself
D) need to manufacture more lysosomes
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two
A bases. How many times would HindIII cut the following DNA molecule?
GTAAGCTTCGACAAGCTTGCTGA
A) 0 times
B) 1 time
C) 2 times
D) 3 times
When plasmids are used to produce a desired protein, the ________.
A) plasmids multiply and produce the protein outside of the bacterium
B) bacterial chromosome is genetically engineered, and the plasmid is used to help the
bacterium replicate
C) desired gene is inserted into the plasmid, and the plasmid is taken up by the
bacterium
D) bacterial genome and plasmid are inserted into the genome of the cell containing the
desired gene
With regard to the environment as a whole, when is the worst time to apply pesticide to
your lawn?
A) when it is raining, or is about to rain
B) when it is cold, or is about to get cold
C) at the same time you apply fertilizer
D) at night
What name is given to a region of DNA that varies from person to person?
A) genetic marker
B) short tandem repeat
C) sticky end
D) restriction fragment
In the soil, some ________ help to decompose dead organisms and other waste
materials, returning vital chemical elements such as nitrogen to the environment.
A) slime molds
B) animals
C) protozoans
D) prokaryotes
When you go outside, it is common to hear a variety of bird songs. These songs vary
among bird species as well as bird flocks. Interestingly, some bird species that are
highly unrelated have very similar song qualities. What can you conclude from this
phenomenon?
A) The bird songs are homologous traits.
B) The bird songs have achieved speciation after coming from allopatric species.
C) The bird songs are analogous traits.
D) The bird songs have different molecular DNA.
Read the following scenario to answer the following questions.
Birds are a widespread group of animals with approximately 10,000 different species
found throughout the world today. Because they are relatively easy to find and so
visually appealing, they have been studied more thoroughly than many other groups of
animals. They are also valuable biological indicators because many species live in
different habitats during different times of the year and cover long migration routes.
According to the World Conservation Union, extinction threatens over 1,200 bird
species today, and at least 179 are critically endangered. Some of the most endangered
species include the Tahiti monarch, with only 10 pairs remaining, and the Bali starling,
with only 12 wild individuals left. In Hawaii, the last captive po’ouli died in 2005, and
the last two known to be alive in the wild have not been seen since 20032004. Common
birds are also disappearing. In North America, red-winged blackbird populations
declined by at least 1 percent each year between 1980 and 1999. These examples can
serve as a warning. Habitat loss through destruction, degradation, and fragmentation are
serious problems that affect 86 percent of threatened birds and are exacerbated by
unsustainable forestry practices and intensifying agriculture. All of this shows that
conservation of habitats is critical if many of the world’s bird species are going to be
saved from extinction in the near future.
What is the greatest threat to birds today?
A) pollution
B) poaching
C) habitat loss
D) the illegal pet trade
Please refer to the following art to answer the following questions.
The first step of the Calvin cycle is the incorporation of ________ into ________.
A) O2… G3P
B) RuBP… O2
C) CO2… RuBP
D) G3P… RuBP
Which of the following structures can perform all the activities required for life?
A) DNA molecules
B) cells
C) organelles
D) nuclei