Unlock document.
This document is partially blurred.
Unlock all pages and 1 million more documents.
Get Access
According to the sliding filament model of muscle contraction, a sarcomere contracts
when its
A) thick filaments slide across its Z lines.
B) thin filaments slide across its Z lines.
C) thin filaments slide toward each other across its thick filaments.
D) thick filaments shorten, pulling the opposed sets of thin filaments past each other.
Through digestion, nucleic acids are broken down into
A) fatty acids.
B) glycerols.
C) nucleotides.
D) amino acids.
Virus-infected cells produce ________, proteins that help neighboring cells fight further
viral infections.
A) lysozymes
B) interferons
C) histamines
D) interleukin-2
What is the preferred name of the technique used to determine if DNA comes from a
particular individual?
A) DNA technology
B) DNA analysis
C) DNA profiling
D) DNA microarrays
To evaluate cardiac function, scientists and physicians measure both the pressure and
the volume inside the heart. When both pressure and volume data are plotted on the
same graph, the resulting graph is called a pressure-volume loop. To create a
pressure-volume loop, a catheter (a thin tube) is inserted into the vessels of the heart,
and measurements of both left ventricular pressure and left ventricular volume are
taken. The data are plotted on a graph, and cardiac function can then be evaluated from
the distribution of the data and the shape of the loop.
The figure below shows a typical left ventricle pressure-volume loop for a healthy
young adult. The cardiac cycle proceeds counterclockwise. Each complete turn around
the loop (for example, starting at point A and ending back at point A) represents one
complete cardiac cycle.
At what point of the diagram is the left ventricle filled with the least amount of blood
and at the highest pressure?
A) point A
B) point B
C) point C
D) point D
Structures that evolved from the same structure in a common ancestor are
A) homologous.
B) heterologous.
C) analogous.
D) convergent adaptations.
Which of the following glands secretes hormones that enable the body to respond to
stress?
A) pancreas
B) adrenal
C) pineal
D) parathyroid
Which of the following statements about the absorption of photons by pigment
molecules is true?
A) It takes several minutes for the pigment electrons to become excited.
B) Photons raise electrons in pigments to the ground state.
C) Excitation of the electrons is a very stable state.
D) Energy can be released by the excited electron as heat, light, or fluorescence.
Thanks to a new conservation program, a population with only 200 individuals at the
beginning of the year is growing exponentially. The population has a per capita birth
rate of 0.5 per year and a death rate of 0.2 per year. What is the growth rate during the
year? What will the population be at the end of the year?
A) growth rate = 60 per year; population = 260
B) growth rate = 6 per year; population = 206
C) growth rate = 260 per year; population = 60
D) growth rate = 30 per year; population = 230
The existence of nest-building in crocodiles and birds led to a prediction that this
behavior was also present in ________.
A) fossil lizards
B) Komodo dragons
C) fossil dinosaurs
D) invertebrates
Fission is an asexual process
A) that allows regeneration of lost body parts.
B) that occurs in individuals that live in isolated areas.
C) in which a parent separates into two individuals of approximately equal size.
D) in which a parent fragments into several pieces.
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret
(^) indicates the cut site. Examine the DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above
DNA molecule with SacI?
A) two
B) three
C) four
D) five
The graph below shows records of temperature (light gray line) and CO2 (dark gray
line) over the past 1,000 years. CO2 is recorded in parts per million (ppm).
Currently, atmospheric CO2 levels are approximately 400 ppm. The annual mean
growth rate in CO2 is about 2 ppm/year. Assuming this trend continues, what would you
predict the CO2 level to be in 100 years?
A) 100 ppm
B) 200 ppm
C) 600 ppm
D) 1,000 ppm
Which part of the mitochondrion shown enhances its ability to produce ATP by
increasing the surface area of a mitochondrial membrane?
A) structure A
B) structure B
C) structure C
D) structure D
Mammals
A) evolved from birds.
B) all give birth to live young.
C) all lay eggs.
D) have hair and mammary glands.
Imagine that we mate two black Labrador dogs with normal vision and find that three of
the puppies are like the parents, but one puppy is chocolate with normal vision and
another is black with PRA (progressive retinal atrophy, a serious disease of vision). We
can conclude that
A) both of the parents are homozygous for both traits.
B) the same alleles that control coat color can also cause PRA.
C) the alleles for color and vision segregate independently during gamete formation.
D) the alleles for color and vision segregate dependently during gamete formation.
You conduct a dihybrid cross. A ________ ratio would make you suspect that the genes
are linked.
A) 3:1
B) 1:1:1:1
C) 12:1:1:4
D) 9:3:3:1
A physiologist is a biologist who studies
A) the structure of body parts.
B) the evolution of animals.
C) the physics of living things.
D) the function of body parts.
Which of the following ecological problems might result from fertilizing a golf course
with phosphorus-rich fertilizer?
A) poisoning of the grass caused by excess phosphorus
B) heavy growth of algae and cyanobacteria in lakes and rivers caused by phosphorus
runoff
C) accumulation of toxic levels of phosphorus in animals in the vicinity, especially
those higher on the food chain
D) a slowdown in the weathering of rock that releases phosphates into the soil under
natural conditions
In a food chain consisting of phytoplankton → zooplankton → fish → fishermen, the
fishermen are
A) secondary consumers.
B) tertiary consumers.
C) quaternary consumers.
D) secondary producers.
Which of the following statements regarding cellular respiration is false?
A) Cellular respiration is a single chemical reaction with just one step.
B) Cellular respiration produces water.
C) Cellular respiration produces carbon dioxide.
D) Cellular respiration releases heat.
According to this figure, at what time in the evolutionary history of plants did vascular
systems likely first evolve?
A) 475 mya
B) 460 mya
C) 425 mya
D) 360 mya
A cell that has neither a net gain of water nor net loss of water when it is immersed in a
solution must be
A) isotonic to its environment.
B) hypertonic to its environment.
C) hypotonic to its environment.
D) metabolically inactive.
Which of the following lists structures involved only in the sense of hearing?
A) middle ear bones, semicircular canals, basilar membrane
B) eardrum, utricle, organ of Corti
C) oval window, cochlea, aqueous humor
D) oval window, basilar membrane, organ of Corti
The central communication conduit between the brain and the rest of the body is the
A) brainstem.
B) nerve bundle.
C) spinal cord.
D) nervous system.
A cell is exposed to a substance that prevents it from dividing. The cell becomes larger
and larger. This situation
A) should present no problem to the cell, since it can continue to perform all other
necessary functions.
B) should present no problem to the cell, because the surface area of the cell will
increase as the volume of the cell increases.
C) will eventually be problematic, since the cell's ability to absorb nutrients through its
outer membrane will not keep increasing as quickly as its cytoplasmic needs.
D) should be beneficial, since the cell will be able to divert the ATP normally used for
cell division to other processes.
Within an ecosystem, a tree is a
A) secondary consumer.
B) detritivore.
C) primary consumer.
D) producer.
The light reactions occur in the ________, while the Calvin cycle occurs in the
________.
A) stroma; thylakoid membranes
B) stroma; nucleus
C) cytoplasm; thylakoid membrane
D) thylakoid membranes; stroma
A woman is having trouble becoming pregnant. Examination of her partner's sperm
indicates that dynein feet are missing from the flagella in his sperm cells. A physician
explains that this could interfere with fertility by
A) preventing the sperm from attaching to the egg cell.
B) preventing the sperm from swimming to the egg cell.
C) preventing the sperm from producing enough energy to power swimming.
D) interfering with the attachment of the flagella to the sperm.
From the left ventricle, oxygen-rich blood flows through the
A) superior vena cava.
B) aorta.
C) pulmonary artery.
D) pulmonary vein.
The hormone prolactin, found in distantly related vertebrates, exerts different effects in
different species. From an evolutionary standpoint, this is an indication that prolactin
A) can only have functions related to childbirth.
B) is an ancient hormone whose function diversified through evolution.
C) was a recent evolutionary adaptation.
D) was not required in fish and amphibians.
The primary goal of conservation biology is to
A) estimate the total number of species that exist.
B) maximize the land set aside for wildlife.
C) integrate human culture back into nature.
D) counter the loss of biodiversity.
Red algae are found in relatively deep water. In order for light to penetrate to these
depths, it must be high in energy. Which wavelengths of light would you expect red
algae to use?
A) red
B) yellow
C) green
D) blue
Which of the following statements regarding carbon is false?
A) Carbon has a tendency to form covalent bonds.
B) Carbon has the ability to bond with up to six other atoms.
C) Carbon has the capacity to form single and double bonds.
D) Carbon has the ability to bond together to form extensive branched or unbranched
"carbon skeletons."
